ID: 951410012

View in Genome Browser
Species Human (GRCh38)
Location 3:22352076-22352098
Sequence ATGATTCTCCAGCAATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951410006_951410012 23 Left 951410006 3:22352030-22352052 CCTTATCTGAGCCAGCCACAAAC 0: 1
1: 0
2: 0
3: 6
4: 139
Right 951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG 0: 1
1: 0
2: 0
3: 6
4: 187
951410009_951410012 8 Left 951410009 3:22352045-22352067 CCACAAACCTTTACACAGTGGCA 0: 1
1: 0
2: 0
3: 15
4: 176
Right 951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG 0: 1
1: 0
2: 0
3: 6
4: 187
951410011_951410012 1 Left 951410011 3:22352052-22352074 CCTTTACACAGTGGCAAGGAAGA 0: 1
1: 0
2: 2
3: 17
4: 189
Right 951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG 0: 1
1: 0
2: 0
3: 6
4: 187
951410007_951410012 12 Left 951410007 3:22352041-22352063 CCAGCCACAAACCTTTACACAGT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG 0: 1
1: 0
2: 0
3: 6
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951410012 Original CRISPR ATGATTCTCCAGCAATATGA TGG Intronic
901072990 1:6532432-6532454 ATAATTCTTCAGCCAAATGAGGG + Intronic
901450616 1:9334569-9334591 ATGGTTGTACAACAATATGAAGG - Intronic
903700478 1:25244147-25244169 ATAATTCTCCAGAAATGTGCAGG - Intronic
903934044 1:26882537-26882559 ATGTTTCTCGAGCCATATGTGGG - Intronic
904250410 1:29219742-29219764 ATGTTTCTGCAGCAAAATGTAGG + Intronic
906114279 1:43345986-43346008 ATTTTTCTCCAGAAAGATGAGGG + Intronic
909801500 1:79815100-79815122 AGGATTCTCCATCAAGATGCTGG + Intergenic
916291055 1:163166640-163166662 ATTATTCTCTAGGGATATGAAGG + Intronic
920023588 1:202975296-202975318 ATGGTCCTCCAGCCATATTAAGG - Intergenic
920182052 1:204138055-204138077 ATGTTTCTCCAGGGATATAAAGG - Intronic
921608051 1:217178160-217178182 AGAATTATCCATCAATATGAAGG + Intergenic
922636184 1:227174132-227174154 ATGATTCTTCAACTTTATGATGG + Intronic
1063207495 10:3847916-3847938 AAAATTCTTCAGCAATGTGATGG + Intergenic
1064150969 10:12864590-12864612 TTGAAACTCCAGCAATATCATGG - Intergenic
1065746083 10:28843662-28843684 AAGAAGCTGCAGCAATATGAAGG - Intergenic
1069771838 10:70905363-70905385 TTGATTCTCAAGAAAGATGAGGG - Intergenic
1072043173 10:91628902-91628924 ATGAGTCACCTTCAATATGAAGG + Exonic
1072680838 10:97505157-97505179 AAAATTCTCCAGCAAGTTGATGG - Intronic
1072931457 10:99666894-99666916 ATGATTTTTCAGCTTTATGATGG - Intronic
1074951096 10:118337328-118337350 ATGATTTACTATCAATATGAAGG + Intronic
1074987761 10:118672549-118672571 ATGAGTCTCCAGAGATCTGATGG + Intergenic
1077921958 11:6647966-6647988 CTGACTCTCCAGGAAGATGAGGG + Intronic
1078592809 11:12659911-12659933 ATCCTTTTCCAGCAATATGGGGG - Intergenic
1078912479 11:15745915-15745937 ATGAATCTCCAAATATATGAAGG + Intergenic
1079428016 11:20362710-20362732 ATGATCCACCAGCCATCTGATGG - Intergenic
1079434746 11:20436558-20436580 ATGATACTTCAACAAAATGAAGG - Intronic
1080491542 11:32769838-32769860 ATGGTTGCTCAGCAATATGAAGG - Intronic
1080646314 11:34190477-34190499 ATGAGTCTCCAGCCTAATGAGGG - Intronic
1080941629 11:36924897-36924919 ATAATTCTTCTGCAATATGGTGG - Intergenic
1080948811 11:37005035-37005057 CTGATTCTCCAGCAACAGAAGGG + Intergenic
1083886397 11:65575535-65575557 ATGATTCTCCAGCTACTTGTCGG + Intergenic
1085268366 11:75251694-75251716 ATGATTGTACAACCATATGATGG - Intergenic
1086239367 11:84670797-84670819 ATGAGTCCACAGCAATATTAGGG - Intronic
1087272012 11:96121391-96121413 ATGATTCCCCAGTAACAGGAAGG + Intronic
1088148970 11:106721030-106721052 ATGCTTCTCCACCAATAAAAAGG + Intronic
1090593070 11:128292946-128292968 AGGCTTCACCAGCAAAATGAGGG - Intergenic
1093508599 12:19899593-19899615 ATGGTTTTCCAGCAATATATGGG + Intergenic
1094120150 12:26964622-26964644 ATGATTCTCGAGTTATTTGAAGG - Exonic
1095288663 12:40448566-40448588 ATCATCCTCCAGCATGATGATGG - Intronic
1095362109 12:41354815-41354837 ATTATTCTACAGGAATGTGATGG - Intronic
1097718452 12:62993993-62994015 ATTAGTCTCCAGCAATTTGTCGG + Intergenic
1098110496 12:67116944-67116966 ATTAATCTCCAGCAAGATTAAGG + Intergenic
1099609298 12:84846842-84846864 ATTTTTCTCTAGAAATATGAAGG - Intergenic
1100520097 12:95366631-95366653 ATCATTCTGTAGCAATATAAAGG - Intergenic
1106885953 13:34184199-34184221 ATGGTTCTCCATCCATATGGTGG - Intergenic
1107562415 13:41569925-41569947 TTGTCTCTCCAGCAATAAGAAGG + Intronic
1108186161 13:47890614-47890636 ATGAGTTTCCAGTAATATCAAGG + Intergenic
1110272882 13:73610735-73610757 ATGTTTTTCCAGTATTATGAAGG + Intergenic
1111827106 13:93281359-93281381 TTTGTTCTCCAGCAAGATGATGG - Intronic
1113133279 13:107061548-107061570 ATGAATCTCATGCAATCTGATGG - Intergenic
1113324894 13:109271614-109271636 CTCATTCTCCAGCAAAATCATGG + Intergenic
1114300233 14:21369545-21369567 ATGATTCTCAAGTAAAATAATGG + Intronic
1117534339 14:56689385-56689407 TTGAGTCTCCAGAAATATTAGGG - Intronic
1117623887 14:57616302-57616324 ATAATTTTCCAGAATTATGAAGG + Intronic
1117736708 14:58775342-58775364 ATGAGTCTCACGCAATCTGAAGG - Intergenic
1120374169 14:83679052-83679074 ATTATTCTCCAGAAACATTAGGG - Intergenic
1120559036 14:85968599-85968621 ATGTTTCTACAGAAAAATGATGG + Intergenic
1122405003 14:101495397-101495419 ATGATTGTACAACAATGTGAGGG + Intergenic
1126261916 15:46703382-46703404 CAGAGTCTCCAGCAATATAATGG + Intergenic
1127328018 15:57914149-57914171 ATGATTCTTCAGGCATAAGAGGG + Intergenic
1127328136 15:57915288-57915310 ATGATTGTTCAGGAATAAGAGGG + Intergenic
1127614361 15:60668902-60668924 ATAATTGTCCAGCTACATGAGGG + Intronic
1127946224 15:63756859-63756881 ATGATTCTCCAGAGAGATTAAGG + Intronic
1130339195 15:82984974-82984996 ATGAAATTCCAGAAATATGATGG + Intronic
1134889506 16:17826906-17826928 TTTATTCTTCACCAATATGATGG - Intergenic
1135740401 16:24970321-24970343 AAGATTCTCCAGCAACCTGGCGG + Intronic
1137581567 16:49636677-49636699 GTGCTTCTCCAGCAGGATGATGG + Exonic
1138461658 16:57151981-57152003 ACAATTCTCCAGCCATGTGAGGG - Intergenic
1138984921 16:62316886-62316908 AGGATTATCCAGCCATATTATGG - Intergenic
1139393459 16:66621382-66621404 ATTCTTCTCCAGGAATATGGGGG - Intronic
1140709995 16:77668770-77668792 ATGATGCTCCAGCAAGCTCAGGG + Intergenic
1146474837 17:33154435-33154457 ATGCTTCCCCAACAATATCATGG + Intronic
1147289160 17:39427702-39427724 ATTATTCTCATGCAAAATGATGG + Exonic
1149264781 17:54915801-54915823 AGTATTCTCCATCAATATGGCGG - Exonic
1153826362 18:8878670-8878692 ATGATCTTCCAGTAAAATGAAGG + Intergenic
1155468756 18:26168804-26168826 AAAATACTCCAGCAAAATGAAGG - Intronic
1158650585 18:59281072-59281094 ATGATTGCACAACAATATGAAGG - Intronic
1159219588 18:65441983-65442005 ATGATGTTCCAGAAACATGAGGG + Intergenic
1159686449 18:71427069-71427091 ATAATTCTCCATAAATATTAAGG + Intergenic
1162471419 19:10873990-10874012 ATGTTACTCCAGGAATAAGATGG - Intronic
1166530157 19:43537707-43537729 AGGATTCTCCAACTTTATGATGG + Intergenic
1167138826 19:47635206-47635228 ATGATTGTACAACATTATGAAGG - Intronic
925074182 2:998738-998760 CTAAATCTCCAGCAAGATGAGGG - Intronic
928558559 2:32452652-32452674 ATGCTTCTCTAACAAAATGAGGG - Intronic
929685932 2:44034670-44034692 ATGATTGTCTTGCACTATGAAGG - Intergenic
933481224 2:82859293-82859315 AAAATGCTCCAGCAAAATGAAGG + Intergenic
937705530 2:124916297-124916319 ATGATTCTTTAGTAAGATGAAGG + Intergenic
939492896 2:142898419-142898441 AGGATTCTCCTGAAATATGAAGG + Intronic
945245869 2:207716612-207716634 ATGATACTCCAACCATCTGATGG - Intronic
948752012 2:240138381-240138403 ATGGGCCTCCAGCAATAGGATGG - Intergenic
1168916490 20:1492469-1492491 AAGATTCTCCAGCAACAGGGTGG + Intergenic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1178470535 21:32888448-32888470 ATGCTTTTCCAGCTATTTGAGGG - Intergenic
1178870611 21:36371630-36371652 ATGATTTTCCAGCTTTATGATGG - Intronic
1180610172 22:17091137-17091159 GATATTCTCCAGCAAAATGAGGG - Intronic
1183652582 22:39166788-39166810 ATGTTTTTCCAGGAATGTGAAGG - Intergenic
951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG + Intronic
951533737 3:23722920-23722942 ATGATTCTCCAAATATATGTTGG + Intergenic
951929152 3:27944149-27944171 TGGATTCTCCATGAATATGAAGG - Intergenic
952065868 3:29569323-29569345 ATGAACCTCCAGCAATTTAAAGG + Intronic
953510174 3:43528696-43528718 CTGAGTCTCCAGCTATATGTTGG - Intronic
954578938 3:51692617-51692639 ATGATTATCCAGCAGCAGGAAGG - Intronic
954973299 3:54670048-54670070 AGGTTTCCCCAGCTATATGATGG - Intronic
955573426 3:60331927-60331949 ATGATTCTCCCACATTATTAAGG + Intronic
956574833 3:70740713-70740735 ATGAGTCTTCGGGAATATGAAGG - Intergenic
957602405 3:82354815-82354837 ATGATTCTTCAGATATTTGAGGG + Intergenic
958432477 3:94059040-94059062 AAAATACTCCAGCAAAATGAAGG - Exonic
958703963 3:97629848-97629870 ATGATGCTTCATCAAGATGATGG + Intronic
960060498 3:113315661-113315683 ATGATTTTTCAGCTTTATGATGG + Intronic
961612082 3:128147874-128147896 ATGATGATCCATCCATATGATGG + Intronic
964653501 3:159040002-159040024 ATCCTTTTCCAGCAGTATGATGG - Intronic
965635979 3:170781128-170781150 ATGATGAGCCAGCAATGTGAGGG + Intronic
970619965 4:17808138-17808160 ATGCTACTACAGCAATATAAAGG + Intronic
971492494 4:27228237-27228259 ATAATTATGCATCAATATGATGG + Intergenic
971812720 4:31447709-31447731 AAAATACTCCAGCAAAATGAAGG - Intergenic
972217072 4:36909389-36909411 ATGATCCTCTAGTAAAATGAAGG - Intergenic
973024540 4:45251028-45251050 ATGATTCTCCACTGATATTAGGG + Intergenic
974153127 4:58035947-58035969 ATGATACTCCAGTAACAAGAAGG + Intergenic
974421843 4:61685847-61685869 ATTATACTACAGTAATATGAAGG + Intronic
974928789 4:68336604-68336626 TTGATTCTGAAGCCATATGATGG + Intronic
978400295 4:108323784-108323806 AGGATTTTTCAGCCATATGAGGG + Intergenic
979026649 4:115586042-115586064 AGTATTCTCTAGCAATGTGAAGG + Intergenic
979555737 4:122044947-122044969 ATGACTCTCCAGCAATGAAAGGG + Intergenic
981060858 4:140423838-140423860 CTGATTCTACAGAAATAAGAGGG - Intronic
981568395 4:146125452-146125474 GTTATTATCCAGAAATATGAAGG + Intergenic
982751935 4:159172477-159172499 AAGATTCTCCAGAAATCAGAAGG - Intronic
983444181 4:167828300-167828322 GTGATTGTCCAGATATATGAGGG + Intergenic
984147257 4:176078119-176078141 AATATTCTGCAGCAATAAGAAGG - Intronic
987144275 5:14976810-14976832 AAGAGTACCCAGCAATATGACGG + Intergenic
989764880 5:45070723-45070745 ATGATTTACCAACAATAAGAGGG - Intergenic
990025854 5:51187753-51187775 AATAATCTCCAGCAATATGGTGG - Intergenic
990076912 5:51857381-51857403 TTGCTTCTCTACCAATATGAGGG - Intergenic
990719056 5:58672710-58672732 ATGATTATTCAGCAATAAAAAGG + Intronic
990935627 5:61145832-61145854 ATCATTCTCCACCAATCTCAGGG - Intronic
992797488 5:80266075-80266097 ATGATGCTTCACCAAAATGAGGG - Intergenic
992797597 5:80267012-80267034 ATGATTCTTCAGCACTGTAATGG + Intergenic
992834537 5:80627168-80627190 AAAATACTCCAGCAAAATGAAGG - Exonic
994965939 5:106670605-106670627 ATAAATCTCAAGCAATCTGATGG + Intergenic
995353119 5:111205276-111205298 ATGGTTCTCAAACAATATGAGGG + Intergenic
995388557 5:111614466-111614488 CTACTTCTCCAGCAATATTAGGG + Intergenic
995463195 5:112423722-112423744 ATAATTCTACAGAAATATGCAGG + Intergenic
1003729246 6:8802625-8802647 ATGATTCTCATGAAATCTGATGG - Intergenic
1004878837 6:19985185-19985207 ATGTTTCTCCAGCCCTATTAAGG + Intergenic
1005198339 6:23314714-23314736 ATGAAACAGCAGCAATATGAGGG + Intergenic
1006053690 6:31364419-31364441 AAAATACTCCAGCAAAATGAAGG - Intergenic
1006586500 6:35118202-35118224 ATGTTACTCCAGGAAGATGATGG + Exonic
1007157912 6:39763811-39763833 ATGCTACTCCATCAAGATGAGGG - Intergenic
1009341600 6:62561420-62561442 ATGTTTCTCCTACAACATGAAGG + Intergenic
1009833187 6:68965807-68965829 ACGATTGTGCAGCAATAGGAAGG - Intronic
1010092238 6:71996775-71996797 ATGCTCCTCCAGCAGCATGATGG - Intronic
1010341624 6:74760083-74760105 ATGGTTCTTCAGCACTTTGAGGG - Intergenic
1012434261 6:99198241-99198263 ATGATTCTCCAAGAACTTGAGGG - Intergenic
1013749092 6:113381262-113381284 ATGATTGACCAGTAAAATGATGG - Intergenic
1017619192 6:156277847-156277869 ATGAGTCTCCTGAAATCTGATGG + Intergenic
1017680494 6:156859041-156859063 ATGATTATGCTACAATATGATGG + Intronic
1019209450 6:170393675-170393697 AAGGTTCTTCAGCAAAATGAGGG - Intronic
1021005149 7:15385584-15385606 ATGAGTCTGGAGCAATATAAAGG - Intronic
1021676781 7:23088250-23088272 AATATTCTGCAGCAATAAGAAGG - Intergenic
1023024409 7:36037673-36037695 ATGATTTTTCAGCTTTATGATGG + Intergenic
1023814607 7:43939940-43939962 ATGGTTCTACAGCATTGTGAAGG + Intronic
1024702701 7:51921819-51921841 ATAATATTCTAGCAATATGAAGG - Intergenic
1024865591 7:53902328-53902350 ATGATTGGCCAGTAATGTGAAGG - Intergenic
1025118650 7:56280238-56280260 ATGTTTCTCCAGAAATTTGAGGG - Intergenic
1026202594 7:68227332-68227354 ATGTTTCTCCAGAAATGTGAGGG - Intergenic
1026457601 7:70586306-70586328 ATATTTCTCCAGCTATATGGTGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027919745 7:84377880-84377902 ATGATTCACCACCAATAACATGG - Intronic
1028356085 7:89910948-89910970 ATAAATCTCTAGCAATTTGAAGG + Intergenic
1028745781 7:94324687-94324709 ATGATTGGCCAGAAATAAGAAGG + Intergenic
1028952663 7:96654411-96654433 ATGGTTTTCCAGCATTATGATGG + Intronic
1031697548 7:124877374-124877396 GTAATTCTCCAGCAATACAATGG + Intronic
1031994692 7:128222192-128222214 ATGATTCTGCAGCTAAATGCTGG - Intergenic
1032754188 7:134872851-134872873 ATTATTCTCCACCAATCTCAGGG + Intronic
1038910388 8:31956815-31956837 ATGACTTTCCAGCAATTTCATGG + Intronic
1042093056 8:65180038-65180060 ATGATTCTCAAGCAAGAAAAAGG - Intergenic
1045239119 8:100383256-100383278 ATGTTTCTCAAACAACATGAAGG + Intronic
1047893988 8:129344728-129344750 CTGATCCTCCAGCTATATCAGGG + Intergenic
1048030529 8:130627596-130627618 AGCAGTCTCCAGCAATCTGAAGG - Intergenic
1051077547 9:13258050-13258072 ATGATTCTCCAACAACTTGTTGG + Intronic
1056050372 9:82762331-82762353 AAGATGCACCAGCAATATGCTGG + Intergenic
1056945105 9:90988076-90988098 CAGATTCTCCTGCAATGTGACGG + Intergenic
1058725407 9:107798809-107798831 ATGATACTCCTGCCATAAGAGGG + Intergenic
1187312358 X:18157482-18157504 ATGATTTTCCAACTTTATGATGG - Intergenic
1189178562 X:38982150-38982172 CTGACTCTCCAGCCATATGCTGG - Intergenic
1189624916 X:42886708-42886730 ATGACTCATCAGCAAAATGATGG + Intergenic
1194153265 X:90353139-90353161 AATATTATTCAGCAATATGAGGG - Intergenic
1194904317 X:99554803-99554825 CTGATACTACAGAAATATGAAGG - Intergenic
1196788573 X:119443698-119443720 ATAATTCTCCATCAAGTTGAAGG - Intronic
1197193686 X:123676920-123676942 ATGATTGTCCAGCAGCATTAAGG - Intronic
1200499606 Y:3929929-3929951 AATATTATTCAGCAATATGAGGG - Intergenic
1201403271 Y:13626361-13626383 ATGCTACTCCAGCAATACTATGG + Intergenic
1202231924 Y:22667316-22667338 ATTATTCTCCAGCCATAGCAAGG + Intergenic
1202311232 Y:23528842-23528864 ATTATTCTCCAGCCATAGCAAGG - Intergenic
1202559570 Y:26141752-26141774 ATTATTCTCCAGCCATAGCAAGG + Intergenic