ID: 951410098

View in Genome Browser
Species Human (GRCh38)
Location 3:22353121-22353143
Sequence AGAAATTTGCTTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951410098_951410105 12 Left 951410098 3:22353121-22353143 CCTTCCACCTCAAGCAAATTTCT 0: 1
1: 0
2: 1
3: 51
4: 460
Right 951410105 3:22353156-22353178 CTGGTTTAGCTTAAATCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 80
951410098_951410104 -7 Left 951410098 3:22353121-22353143 CCTTCCACCTCAAGCAAATTTCT 0: 1
1: 0
2: 1
3: 51
4: 460
Right 951410104 3:22353137-22353159 AATTTCTGGTGTGGGAAGTCTGG 0: 1
1: 0
2: 8
3: 82
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951410098 Original CRISPR AGAAATTTGCTTGAGGTGGA AGG (reversed) Intronic
901688299 1:10956839-10956861 AGAAGTTTGCTTTTGCTGGAAGG - Intronic
901934968 1:12620594-12620616 AGAAGCTGGCCTGAGGTGGATGG + Intergenic
902679924 1:18036126-18036148 AGAAAGTAGCTTGATGTGGTTGG + Intergenic
903976608 1:27154477-27154499 AGCAATTTTCTGGGGGTGGAGGG + Exonic
904335863 1:29797569-29797591 AGAAATTGTATTGAGGTAGAAGG - Intergenic
905069401 1:35212176-35212198 AGAGGATTGCTTGAGGTGGGAGG - Intergenic
906879613 1:49576045-49576067 AGAAATTTTACTGAGGTAGAAGG - Intronic
907780278 1:57560415-57560437 AGAAATTTTACTGAGGTAGAAGG - Intronic
908525251 1:64981615-64981637 ATCAATTTGCTTGAGATGGCTGG + Intergenic
909257221 1:73439226-73439248 AGAAGTTTGCTGGAGGGGCAAGG + Intergenic
909271098 1:73625247-73625269 AGAAATTTGCTTGGAGTAGTAGG - Intergenic
909349994 1:74640587-74640609 AAACATTTGCTGGAGGTTGATGG - Intronic
909576846 1:77185440-77185462 AGAAATTTTACTGAGGTAGAAGG - Intronic
909810889 1:79930930-79930952 AGAAATTTTACTGAGGTAGAAGG - Intergenic
910297613 1:85666124-85666146 AGGAATTTACTAGAGGTGAAAGG + Intronic
910790247 1:91043303-91043325 AGAAATTTTACTGAGGTAGAAGG - Intergenic
911883501 1:103270039-103270061 AGAAATTTTACTGAGGTAGAAGG - Intergenic
912066960 1:105756529-105756551 AGAAATTTTACTGAGGTAGAAGG - Intergenic
912263639 1:108132696-108132718 AGAAATTTGCTTAAGTAGCAAGG - Intergenic
913079964 1:115374597-115374619 AGACATTGACTAGAGGTGGAAGG - Intergenic
914422258 1:147540291-147540313 AGGAATTTGATTGGTGTGGAGGG - Intergenic
915667736 1:157460062-157460084 AGAAATTTTACTGAGGTAGAGGG + Intergenic
916106406 1:161435745-161435767 AGAAATTTTACTGAGGTGGAAGG + Intergenic
916285251 1:163099119-163099141 AGAAATTTTACTGAGGTAGAAGG - Intergenic
916814425 1:168337702-168337724 AGAAGTTTGCTGCAGGTGGAGGG - Intergenic
918072782 1:181145507-181145529 AGCAAATTGCATGGGGTGGAAGG + Intergenic
918774429 1:188610329-188610351 AGAAATTTTACTGAGGTAGAAGG - Intergenic
918778145 1:188665156-188665178 AGAAGTTTGCTTCAGGGGCAGGG + Intergenic
918815009 1:189170810-189170832 GGAAATTTTCCTGAGGTAGAAGG - Intergenic
919481589 1:198096712-198096734 AGTAATTTCCTCGAAGTGGAGGG + Intergenic
921113289 1:212060582-212060604 AAAAATTAGCTTGACGTGGTAGG + Intronic
921683747 1:218065773-218065795 AGAAGTTTGCTTTAAGTGGATGG - Intergenic
922106859 1:222519999-222520021 TGAAAGTTACTTGAGGAGGAGGG - Intergenic
922338776 1:224638916-224638938 AGAAACTTCCTGGAGGAGGAAGG - Intronic
922683005 1:227616514-227616536 ACAAATTTCCCTGAGGTAGAAGG - Intronic
923253631 1:232199851-232199873 AGAAATTTTACTGAGGTAGAAGG + Intergenic
923924546 1:238609880-238609902 AGAAATTTAAGTGAGGTGGTGGG + Intergenic
924491780 1:244545179-244545201 AGAAATTTCACTGAGGTAGAAGG - Intronic
924840847 1:247708249-247708271 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1063604013 10:7507330-7507352 AGAAGTTTCATTGAGGTGGAGGG + Intergenic
1066543656 10:36476067-36476089 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1067971877 10:50980958-50980980 AAAAATTTTCTAGAGATGGATGG + Intergenic
1068235436 10:54227211-54227233 AGAAGTTTGCTTCAGGGGCAGGG - Intronic
1068321718 10:55426817-55426839 AGAAATTGGCCAGAGGTGGCCGG - Intronic
1068455922 10:57253753-57253775 AGAAATTGGCTTGAGGTATCTGG + Intergenic
1070457840 10:76634476-76634498 CAAACTTTGCTTGAGGAGGAAGG + Intergenic
1071364531 10:84884943-84884965 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1071409832 10:85378137-85378159 AGAAATATGCTTGGGGTGGCAGG - Intergenic
1071590364 10:86866658-86866680 AGAAACTTGCCTGAGTTGGCCGG - Intronic
1072963416 10:99951263-99951285 AGAAGTTTGCTGCAGGTGCAGGG + Intronic
1074262662 10:111870016-111870038 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075394932 10:122120332-122120354 AGAAAATTGTTTGGGCTGGAGGG + Intronic
1075851735 10:125593814-125593836 AGAAAGTTTCTGGAGATGGATGG + Intronic
1076233896 10:128848829-128848851 GGAAATTGACTTGAGCTGGATGG - Intergenic
1076927484 10:133499644-133499666 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1077401138 11:2358067-2358089 GGAAATTTCCCTGAGGTAGAAGG - Intergenic
1078242160 11:9539554-9539576 TGTTATTTGCTTGAGGTGGAGGG - Intergenic
1082766253 11:57170038-57170060 AGAAATTTGCATGAGTAGCAGGG - Intergenic
1083093073 11:60220681-60220703 AGAAATTTTACTGAGGTAGAAGG - Intronic
1083663112 11:64261212-64261234 GGAAAATTGCTTGAGCTGGGTGG + Intronic
1084349513 11:68585410-68585432 AGAGATTTGCTTAAAGTGGTTGG + Intronic
1085821711 11:79800949-79800971 AGAGCTTAGGTTGAGGTGGAAGG - Intergenic
1085934839 11:81128484-81128506 TGAAATTTATTTGAGATGGATGG + Intergenic
1086023873 11:82266485-82266507 AGAAAGTTGCCTGGGGTAGATGG - Intergenic
1086598870 11:88608095-88608117 AGAAATCTGCCTAGGGTGGATGG - Intronic
1086834051 11:91599949-91599971 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1088183580 11:107139188-107139210 GGAAATTTGCTTAATGTAGAAGG + Intergenic
1088191728 11:107234934-107234956 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1089776556 11:120841200-120841222 AAAAATGTTCTGGAGGTGGATGG - Intronic
1090184370 11:124726845-124726867 AGAAAATTGCTTGAACTGGGAGG + Intergenic
1091051667 11:132378311-132378333 AGAAATTTCACTGAGGTAGAAGG - Intergenic
1091256926 11:134196553-134196575 GGAGATTTGCTTGAGCTGGGAGG + Intronic
1091705927 12:2693339-2693361 AGAAAATTCCGTGTGGTGGAAGG - Intronic
1092750832 12:11717953-11717975 AGAAATTTGCATGAGGTAAGGGG - Intronic
1093036228 12:14334900-14334922 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1093048990 12:14485395-14485417 AGAAATTTTACTGAGGTAGAAGG + Intronic
1093999763 12:25682521-25682543 AAAAAATTGCTTGTTGTGGAAGG + Intergenic
1094102459 12:26778820-26778842 AGAAATTTTACTGAGGTAGAAGG - Intronic
1096183007 12:49560893-49560915 AGACATTGGCTTAAGGTGGGCGG - Intronic
1096457541 12:51799880-51799902 AGAAATTTCACTGAGGTAGAAGG + Intronic
1097360548 12:58654403-58654425 AGAAATTTGCTTGAGTAGCAAGG - Intronic
1098733234 12:74065199-74065221 AGAAATTTTACTGAGGTGGAAGG - Intergenic
1099020391 12:77396275-77396297 AGTAATTTAGTTGGGGTGGAAGG + Intergenic
1099365860 12:81764943-81764965 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1099578021 12:84405020-84405042 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1100174016 12:92008913-92008935 ATTAATTTGCTTGAGGGGGTAGG + Intronic
1100686570 12:96992741-96992763 AGAAAATTCCTTGTGGTGGGTGG - Intergenic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1101518010 12:105454937-105454959 ATAAAATGGCTTGAGGTTGAAGG + Intergenic
1101534737 12:105606547-105606569 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1101667291 12:106830752-106830774 AGATATGTGCATGAGGGGGAGGG - Intronic
1102211297 12:111129122-111129144 AGATATTTCACTGAGGTGGAAGG + Intronic
1102837738 12:116081756-116081778 ACTAATGTGATTGAGGTGGAAGG + Intronic
1103097382 12:118142998-118143020 AAAAATTTGCTGGATGTGGTAGG - Intronic
1103396460 12:120611006-120611028 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1104808112 12:131602321-131602343 AGAAATTTGCTTAAGTGAGAAGG - Intergenic
1105585902 13:21742532-21742554 ATAAACTGGCTGGAGGTGGAGGG - Intergenic
1106262366 13:28078650-28078672 AGAAATTTGCATAAGTTGCAAGG - Intronic
1106649392 13:31673501-31673523 AGAAAGTTGCTTCAGCTGGAGGG + Intergenic
1107405220 13:40105951-40105973 AGGAATTTTCTTGAGGGGGCTGG + Intergenic
1107640047 13:42432942-42432964 AGAAATGTGCTTCAGGCAGAAGG - Intergenic
1108166787 13:47701594-47701616 AGAAATTTCACTGAGGTGGCAGG - Intergenic
1108328319 13:49357738-49357760 AGAAAATAGCTTGGGGTGGGAGG - Intronic
1108889112 13:55230595-55230617 AGAAATTTTACTGAGATGGAAGG - Intergenic
1109670822 13:65604393-65604415 AAAAATTAGCTTGATGTGGTGGG - Intergenic
1109832652 13:67812405-67812427 AGAAATTTGCATGAGTAGCAAGG - Intergenic
1109933355 13:69245617-69245639 AGAAATTTCACTGAGGTAGAAGG + Intergenic
1110143916 13:72166387-72166409 AGAAATTTCCTTGGGGTTGAGGG + Intergenic
1110762897 13:79250382-79250404 AGAATTTTTTTTGAGGGGGAGGG - Intergenic
1111055865 13:82949972-82949994 AGTAACTTGCTTTAGGTGGGAGG + Intergenic
1111057853 13:82973394-82973416 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1112249995 13:97770675-97770697 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1113105017 13:106762379-106762401 AGAAAATTGTTTGAGGAGCAAGG - Intergenic
1113396124 13:109949419-109949441 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1114334205 14:21670903-21670925 AGAAGTTTGATTGAGTAGGATGG + Intergenic
1114405589 14:22453138-22453160 AGAAAATGGCTCCAGGTGGAAGG - Intergenic
1114758326 14:25284319-25284341 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1114798129 14:25739972-25739994 AGAAGTTTGCTGCAGGGGGAGGG - Intergenic
1114812539 14:25917434-25917456 AGAAGTTTGCTTCAGGGGCAGGG + Intergenic
1115059642 14:29173451-29173473 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1115070738 14:29319187-29319209 AGAAATTTCACTGAGGTAGAAGG - Intergenic
1115310918 14:31976933-31976955 AGAAATTTCAGTGAGGTGGAAGG + Intergenic
1115361398 14:32507359-32507381 AGAAATAATCTTAAGGTGGAAGG + Intronic
1115875326 14:37854667-37854689 AGAAAGATCCTTCAGGTGGAAGG - Intronic
1116138630 14:40959552-40959574 AGAAGTTTGCTGTAGGTGCAGGG - Intergenic
1116158447 14:41237109-41237131 AGAAATTTTACTGAGGTAGAGGG + Intergenic
1116308102 14:43283880-43283902 AGAAATTTCACTGAGGTAGAAGG + Intergenic
1116762106 14:49027171-49027193 AGAAATTTGCTGCAGGGGCAGGG + Intergenic
1116989860 14:51263894-51263916 AGAATATTAATTGAGGTGGATGG - Intergenic
1117805989 14:59491198-59491220 TAAAATGTGTTTGAGGTGGAGGG + Intronic
1118669069 14:68102279-68102301 AGAAATTTGCTTAAGTAGCAAGG - Intronic
1118880834 14:69824443-69824465 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1119059766 14:71462618-71462640 AGAAATTTTACTGAAGTGGAAGG + Intronic
1119107636 14:71939282-71939304 AGAAATTTTATTGGGGTAGAAGG + Intronic
1119286142 14:73457292-73457314 AGAAATTTGTTTTAGGATGATGG - Intronic
1119556533 14:75557715-75557737 AGAAATCTGCTTCAGGGGAACGG - Intergenic
1119795766 14:77395649-77395671 AAAAATTAGCTGGATGTGGAGGG + Intronic
1120169345 14:81233544-81233566 AGAAATTTAATTGAGATAGAAGG - Intergenic
1120231485 14:81845693-81845715 AGAAATTTCATTGAGGTAGAAGG + Intergenic
1120822553 14:88926256-88926278 AGGAAGTTGCTTGGGGAGGAAGG + Intergenic
1121623796 14:95370080-95370102 AGAAATCTGTTTGAAGGGGATGG - Intergenic
1121709454 14:96026803-96026825 AGAAATATGCTCTAGGAGGAAGG + Intergenic
1121994659 14:98592944-98592966 AGAGATCTGCTTGAAGTGGCAGG - Intergenic
1124475815 15:30033540-30033562 AGAAACATAATTGAGGTGGAAGG - Intergenic
1125304276 15:38291907-38291929 AGAAATTTGCTTAAGTAGAAAGG - Intronic
1126472360 15:49027392-49027414 AGACATTTTCTAGAGGTGGAAGG - Exonic
1127979142 15:64021554-64021576 AGCCATATGCTAGAGGTGGAAGG + Intronic
1130789305 15:87135107-87135129 AGATATTGGCTTGAAATGGAAGG - Intergenic
1131371531 15:91885918-91885940 TGAAATATGCTTGATGTGGTCGG + Intronic
1131541306 15:93277672-93277694 GGAAAATTGCTTGAGGTTTATGG + Intergenic
1133713960 16:8429108-8429130 AGAAATATGCTTTGGGTGGCTGG - Intergenic
1133842914 16:9426429-9426451 ACTATTTTGCTGGAGGTGGAGGG + Intergenic
1134351640 16:13443210-13443232 AGAGATTTTATTGAGGTTGATGG + Intergenic
1134818429 16:17226010-17226032 GGAAATTTGCATGAGGTAGTGGG + Intronic
1137827407 16:51511161-51511183 AGAAGTTTGCTGGAGGTGAGAGG + Intergenic
1138161149 16:54756128-54756150 AGAAATTTGGTTGAGGAGTAAGG - Intergenic
1138524940 16:57599662-57599684 ACACATGTACTTGAGGTGGAAGG - Intergenic
1138868319 16:60850347-60850369 AGAAATTTTACTGAGGTAGAGGG - Intergenic
1140399470 16:74659054-74659076 AGAAAATTGCTTGATGTGGCTGG - Intronic
1143440143 17:6965038-6965060 GGAAAACTGCTTGTGGTGGATGG - Intronic
1143973251 17:10811236-10811258 AAAAATGTTCTGGAGGTGGATGG - Intergenic
1146237912 17:31185509-31185531 AGAAATTTTACTGAGGTAGAAGG - Intronic
1146335463 17:31966355-31966377 TGAAATTTGTTTTTGGTGGATGG + Intronic
1146971865 17:37079888-37079910 TGAAATGTTCTGGAGGTGGATGG - Intergenic
1149427030 17:56565231-56565253 AGAAATTTCACTGGGGTGGAAGG - Intergenic
1149837991 17:59931279-59931301 AGAAATTTGCTTGAAATGAATGG + Intronic
1150081300 17:62241957-62241979 AGAAATTTGCTTGAAATGAATGG - Intergenic
1150727293 17:67661619-67661641 AGAAATGTGGTCAAGGTGGAAGG + Intronic
1153217763 18:2836049-2836071 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1154254072 18:12767711-12767733 AAAAATTAGCTGGAGGTGGTGGG + Intergenic
1154257379 18:12795279-12795301 AGAAATTTTTTTGGGGTGGTGGG + Intronic
1154506108 18:15042429-15042451 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1156303795 18:35858261-35858283 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1156940921 18:42766625-42766647 AGAAATTTGCATAAGTAGGAAGG + Intronic
1156990376 18:43401226-43401248 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1157341141 18:46779644-46779666 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1159791917 18:72792327-72792349 AGAAAATCGCTTGAGGTGGGAGG + Intronic
1162197462 19:8996551-8996573 GGAAATGTGCTTGTGATGGAGGG + Intergenic
1164200097 19:23010824-23010846 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1165441753 19:35832214-35832236 AGAAGTTTGCTTGAGAAGAAAGG - Intronic
1167403413 19:49288285-49288307 AGAAATTTGCATGAGTAGCAAGG + Intergenic
1167406358 19:49311138-49311160 AGAAATTTGCTTGGGCTGACTGG + Exonic
1168539409 19:57197821-57197843 AGAAATTTTACTGAGGTAGAAGG + Intronic
925291887 2:2753532-2753554 AGAAATTTGCATGAGTAGCAAGG + Intergenic
925460655 2:4059999-4060021 AGAAATTTTACTGAGGTAGAAGG - Intergenic
926418387 2:12673443-12673465 AAAAATATGCTTGAGGTCCAAGG + Intergenic
927660359 2:24988217-24988239 AGAAATTTTACTGAGGTGGAAGG - Intergenic
928231425 2:29501782-29501804 AGAAATGTTCTAGAGATGGATGG - Intronic
929311518 2:40431500-40431522 AGAGTTTTGCTTGAGCTGGTGGG - Intronic
929316467 2:40484869-40484891 AGAAGGATGCTGGAGGTGGAAGG + Intronic
929852079 2:45601247-45601269 AGAAATTTACTTGATGAGCATGG - Intronic
930698781 2:54438866-54438888 AGAAAATTGCTTTAGGGAGAAGG - Intergenic
930796676 2:55399435-55399457 AGAGAATTGCTTGAGCTGGGAGG + Intronic
930844945 2:55893411-55893433 AGAAATATGCTTGAGACAGAAGG + Intronic
930852262 2:55973644-55973666 AGAAATTTCACTGAGGTAGAAGG + Intergenic
930924403 2:56799240-56799262 AGAAATATACTTGGGGGGGAAGG + Intergenic
931097638 2:58959697-58959719 AGAAATTTACTTGAAATGTAGGG + Intergenic
931637609 2:64354923-64354945 AGAAGTTTGCTTGTGGTTGAAGG - Intergenic
931727296 2:65123582-65123604 AGCAATTTGGCTGAGGTGGGTGG + Intronic
932674507 2:73767187-73767209 AGATATTTGATTGATGTAGAAGG - Exonic
933065041 2:77781861-77781883 AGAAGTTTGCTTCAGGGGCAGGG + Intergenic
933418761 2:82022288-82022310 AGAAATTTGCTATAGGTGCAGGG - Intergenic
933454363 2:82502319-82502341 AGAAGTTTGCTGCAGGTGCAGGG + Intergenic
935029668 2:99309979-99310001 AGAAATTTGCCCGAGGAGGCTGG - Intronic
935254782 2:101300116-101300138 ACAATTTTGCTTGGGGTGGAGGG + Intronic
935564379 2:104590700-104590722 AGAAATTTTCCTGAGGTAGAAGG + Intergenic
936085121 2:109462031-109462053 AGAAATTTCACTGAGGTAGAAGG + Intronic
936639476 2:114296060-114296082 AGAAAGTTGCCTAAGGTGGTCGG + Intergenic
936838584 2:116740582-116740604 AAAATTATGCTGGAGGTGGAAGG + Intergenic
937255392 2:120551928-120551950 AGCACTTTCCATGAGGTGGATGG - Intergenic
939068998 2:137517412-137517434 AGAAATTTTACTGAGGTAGAAGG - Intronic
939087118 2:137734442-137734464 AGAAACTTGCTTTCGGTTGAAGG - Intergenic
941142794 2:161805960-161805982 AGAAATTTGCTTCAGGGGCAGGG - Intronic
941173763 2:162171881-162171903 GGAAATTTGTTTGAGGTGATGGG - Intronic
941811336 2:169758669-169758691 AAAAATTAGCTGGAGGTGGTGGG - Intronic
942382389 2:175405469-175405491 AGAAAAATGCTTGGGGTTGAGGG - Intergenic
943006833 2:182395449-182395471 AGAAACTTCCCTGAGGTAGAAGG - Intronic
943388065 2:187226693-187226715 AGAAATTTTACTGAGGTAGAAGG - Intergenic
943832903 2:192485335-192485357 AGAAGTTTGCTGGAGGGGCAGGG + Intergenic
943984265 2:194599661-194599683 AGAGAGTTGCTTGAGGTGGGAGG - Intergenic
944369876 2:198969705-198969727 AGACATTTGGTTGAGGGGAATGG + Intergenic
944625865 2:201568150-201568172 AGAAATTTCACTGAGGTAGAAGG + Intronic
945360135 2:208886792-208886814 AGAAATTTGCTTCAAGGGCAGGG + Intergenic
946527932 2:220540412-220540434 AGAAATTTTACTGAGGTAGAAGG + Intergenic
947054408 2:226084542-226084564 AGAAGTTTGCTGCAGGTGCAGGG - Intergenic
947927836 2:233937190-233937212 AGAAACTAGTTTGATGTGGACGG - Intronic
948340484 2:237246739-237246761 AGAAATTTCGCTGAGGTAGAAGG + Intergenic
1169024920 20:2362241-2362263 TGGAATTTGCTTCAGCTGGAGGG + Intergenic
1171330126 20:24330093-24330115 AGAAATTTCACTGAGGTAGAAGG + Intergenic
1173711054 20:45156040-45156062 AGAAGTTTGCTTCAGGAGCAGGG + Intergenic
1175492420 20:59388227-59388249 GGAAAATTGCCTGTGGTGGAGGG + Intergenic
1176791746 21:13326595-13326617 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1176998092 21:15579765-15579787 AGAAATTTTACTGAGGTGGAGGG - Intergenic
1177396386 21:20540498-20540520 AGATATTTGCCTGGGGTTGAAGG + Intergenic
1177478174 21:21651159-21651181 AGAAGTTTGCTTCAGGGGCAGGG + Intergenic
1177915214 21:27080860-27080882 AGAAATATGTTGGTGGTGGATGG - Intergenic
1177940971 21:27410927-27410949 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1179415216 21:41192956-41192978 AGAAATTTTACTGAGGTAGAAGG + Intronic
1180253877 21:46609011-46609033 AGAAACTTCACTGAGGTGGAGGG - Intergenic
1181420587 22:22795386-22795408 AGAAATTTTACTGAGGTAGAAGG - Intronic
1181930467 22:26396587-26396609 AGAAATTGGCTTGGGGTAGAGGG + Intergenic
1182650630 22:31848365-31848387 AGAAGTTTGCTTCAGGGGCAGGG - Intronic
1182915186 22:34022894-34022916 AGAAATCTGCTTGATGTTTATGG - Intergenic
1184603630 22:45558814-45558836 AGAAATTTTACTGAGGTAGAAGG + Intronic
949125732 3:443590-443612 AGAAATTTTACTGAGGTAGAAGG + Intergenic
949245806 3:1924483-1924505 AGAAATTTTACTGAGGTAGAAGG - Intergenic
949509363 3:4754792-4754814 CAAAATTTGCCTGAAGTGGAAGG - Intronic
949644819 3:6081109-6081131 AGAACTGGGCTTGAGGTAGAAGG + Intergenic
950586159 3:13894133-13894155 AGAAATTTGCTAAAGGGAGAAGG - Intergenic
951291590 3:20877179-20877201 AGAAATTTTACTGAGGTAGAAGG + Intergenic
951410098 3:22353121-22353143 AGAAATTTGCTTGAGGTGGAAGG - Intronic
951801729 3:26603687-26603709 AGAAATTTGTTGCAGGTGCAAGG - Intergenic
953479251 3:43235674-43235696 AGAAAAGTTCTGGAGGTGGATGG - Intergenic
953623458 3:44551979-44552001 AGAAAGTTGCCTGTGGTGGCTGG - Intergenic
953899375 3:46830873-46830895 AGAATTCTGCTTGAGTTGGAGGG - Intronic
954516950 3:51186898-51186920 AGAAGTTTGCTTCAGGGGCAGGG + Intronic
956115588 3:65914742-65914764 ACAAATTTGCTTATGGTGGATGG + Intronic
958055170 3:88400948-88400970 AGAAATTTGACTGAGATGTAGGG + Intergenic
958482257 3:94657644-94657666 AGAAATTTGCTTGGTGCAGAAGG + Intergenic
958563817 3:95781696-95781718 AGAAATTTGCTGCAGGGGAAGGG + Intergenic
958934239 3:100240194-100240216 AGAAATTTTACTGAGGTAGAAGG - Intergenic
959437386 3:106333215-106333237 AGAAACTATCCTGAGGTGGAGGG - Intergenic
959579775 3:107971423-107971445 ATACATTTGCTGGGGGTGGAAGG + Intergenic
959746079 3:109777719-109777741 AGAAATTTTACTGAGGTAGAAGG + Intergenic
959997798 3:112697876-112697898 AGAAATTTTACTGAGGTAGAAGG - Intergenic
960698626 3:120419435-120419457 AGAAAGTTGCTTAGGGTGGTGGG + Intronic
961262785 3:125616063-125616085 AGAAATTTCCCTGAGGTAGAAGG - Intergenic
961860733 3:129915389-129915411 AGAAATCAGCTAGAGGTGCATGG + Intergenic
962551045 3:136492022-136492044 TCAAATTTGTTTGAAGTGGATGG + Intronic
962629359 3:137260096-137260118 AGAAATTTGCATGAAGTCAACGG - Intergenic
963783902 3:149513679-149513701 AGATATTTGGTGGAGGTGGGGGG + Intergenic
964043689 3:152296138-152296160 AGATATTTGCTTGGGAAGGATGG + Intronic
964528601 3:157643167-157643189 AGAAATCTGCTTGATGAGGGTGG + Intronic
966216965 3:177513869-177513891 AGAACTTTGGTTGAGTTGAAAGG + Intergenic
966369610 3:179234907-179234929 AGAAAAATGCTTGGGGTGGAAGG + Exonic
966445618 3:179998113-179998135 AGAAATTTTACTGAGGTAGAAGG - Intronic
967154977 3:186683874-186683896 AGAAATTTGCTGCAGGGGCAGGG - Intergenic
967275360 3:187768800-187768822 ATCAATTTGGATGAGGTGGAAGG + Intergenic
967449963 3:189613080-189613102 AGAAATTTGCTTAAGTAGCAAGG + Intergenic
970382107 4:15518615-15518637 AGAAGTTTGCTGCAGGGGGAGGG - Intronic
970697649 4:18696743-18696765 TGGAATTTGCATGTGGTGGAAGG + Intergenic
971148356 4:24004541-24004563 TGAAATTTGCTTTAGGTTAATGG - Intergenic
971460609 4:26891819-26891841 AGAAATTTCACCGAGGTGGAAGG + Intronic
971569907 4:28198099-28198121 GGAAAGCTGCTTGGGGTGGATGG + Intergenic
971817158 4:31504620-31504642 AGAAATTTCCCTGAGGTAGAAGG - Intergenic
971823100 4:31585105-31585127 AGGAATTTGGGTGGGGTGGAGGG + Intergenic
972920369 4:43932424-43932446 AGAATTTTGCATAAGGTGAAAGG - Intergenic
973118365 4:46488597-46488619 AGAAATTTTACTGAGGTTGACGG - Intergenic
973143627 4:46798163-46798185 AGAAATTTCACTGAGGTAGAAGG - Intronic
974564724 4:63567868-63567890 AGAAATTTTATTGAGGTAGAAGG - Intergenic
975403352 4:73962414-73962436 AGAAATTTGCTGCAGGGGCAGGG + Intergenic
975656978 4:76651308-76651330 GGAAAGATGCTTGAGGGGGATGG + Intronic
976208957 4:82648251-82648273 AGAAGTTTGCATGTGGTGGAGGG - Intronic
976244040 4:82989792-82989814 AGAAGTTTGGTTGAGCTGCAGGG - Intronic
977031556 4:91890962-91890984 AGAAATTTTACTGAGGTAGAAGG - Intergenic
977031671 4:91891792-91891814 AGAAATTTTACTGAGGTAGAAGG + Intergenic
977076471 4:92457860-92457882 AGAAATTTCTTTAAGGGGGAAGG - Intronic
977120313 4:93091572-93091594 ACCAATTTGCTGGAGGTAGAGGG - Intronic
977337422 4:95716520-95716542 AGAAATTTCCCTGAAGTAGAAGG + Intergenic
978226251 4:106338608-106338630 AGAAATTTGCTCTAGGGGCAGGG + Intronic
978899146 4:113927278-113927300 AGAAATTTTACTGAGGTAGAAGG + Intronic
979416357 4:120445009-120445031 TTAAATTTTCTTGAGGTGCATGG + Intergenic
979510894 4:121552349-121552371 AGAAAATTGCCTGATGTGAAAGG + Intergenic
980348837 4:131662774-131662796 ACAAAGTTGCCTGAAGTGGATGG + Intergenic
980380416 4:132006852-132006874 AGAAATATGCTGCATGTGGAGGG + Intergenic
980582329 4:134771238-134771260 AGAAATTTCACTGAGGTAGAAGG + Intergenic
980602098 4:135039033-135039055 AGAAATTTTCCTGAGGTAAAAGG - Intergenic
980957661 4:139445475-139445497 AGAAATTTTACTGAGGTAGAAGG - Intergenic
981462748 4:145031360-145031382 AGAAATTTTACTGAGGTCGACGG - Intronic
981846290 4:149173970-149173992 AGATATTTGAATGAGGGGGAAGG - Intergenic
981861429 4:149361341-149361363 AGAAATTTGCATGAGTAGCAAGG + Intergenic
984060357 4:174982470-174982492 AGAAATTTTACTGAGGTAGAAGG + Intergenic
984599470 4:181709943-181709965 AGAAGTGTATTTGAGGTGGATGG + Intergenic
984679686 4:182593365-182593387 AGAAACTGGGTGGAGGTGGAGGG - Intronic
986037103 5:3950878-3950900 AGAAATTTTACTGAGGTAGAAGG + Intergenic
986087049 5:4462273-4462295 AGAAATTTTACTGAGGTAGAAGG - Intergenic
986233925 5:5890367-5890389 AGAAACTTTCATGGGGTGGAGGG + Intergenic
986640599 5:9868275-9868297 AGAAGTTTGCTTCAGGGGCAGGG - Intergenic
986742848 5:10719060-10719082 AGAAATTTTACTGAGGTAGAAGG - Intronic
987153112 5:15061230-15061252 AGAAATTTTACTGAGGTAGAAGG - Intergenic
987541446 5:19261186-19261208 AGAAATTTGCTGCAGGGGTAGGG + Intergenic
987659572 5:20855057-20855079 AGAAATTTGCTGCAGGGGCAGGG + Intergenic
988079894 5:26401860-26401882 AGAAATTTTACTGAGGTAGAAGG + Intergenic
988426912 5:31074636-31074658 AGAAATTTGCTTAAGTAGCAAGG - Intergenic
988764072 5:34350590-34350612 AGAAATTTGCTGCAGGGGCAGGG - Intergenic
988886043 5:35559079-35559101 AGAAGTTTGCTGCAGGTGCAGGG - Intergenic
988886420 5:35563289-35563311 AGAAGTTTGCTGCAGGTGCAGGG + Intergenic
988993017 5:36689957-36689979 AGAATTTTGCTTGGGTGGGAAGG - Intergenic
989097757 5:37796877-37796899 AGAAATTTTACTGAGGTAGAAGG - Intergenic
989532499 5:42524593-42524615 AGAAATTTGCATGAGTAGCAAGG + Intronic
989542646 5:42635664-42635686 AGAAAATTGCTTGAAGTTGAAGG - Intronic
990211788 5:53488274-53488296 AGAAATTTGGTGGAGGTAGAGGG + Intergenic
990623297 5:57583681-57583703 ATATATTTGCTTGAGGGGAAAGG + Intergenic
990974659 5:61548821-61548843 AGATGTATGTTTGAGGTGGAAGG + Intergenic
991033474 5:62105479-62105501 AGAAATTTTACTGAGGTAGAAGG - Intergenic
991117289 5:62969536-62969558 AGAAATTTGCTTTATTTAGAGGG - Intergenic
991330803 5:65490126-65490148 AGAAATTTTACTGAGGTAGAAGG + Intergenic
992081797 5:73240552-73240574 AGAAATTTGGTAGAGCTGGTGGG + Intergenic
993299083 5:86184237-86184259 AAATATGTGCTTGAGGTGGTTGG - Intergenic
993412642 5:87592256-87592278 AGAAATTTTACTGAGGTAGAAGG + Intergenic
993965774 5:94358738-94358760 AGACATTTCCCTGAGCTGGAAGG + Intronic
995427804 5:112044170-112044192 AGAAATTTTACTGAGGTAGAAGG + Intergenic
995431753 5:112087193-112087215 AGAAACCTGCTTGGGATGGAGGG - Intergenic
996165026 5:120212952-120212974 AGAAATTTTACTGAGGTAGAAGG + Intergenic
996488711 5:124067028-124067050 AGAAATTTCCTTGTGGTAGAAGG + Intergenic
996825491 5:127677390-127677412 AGAAATTTTACTGAGGTAGAAGG - Intergenic
997663621 5:135609032-135609054 TGATATTTCCTGGAGGTGGAAGG + Intergenic
998290400 5:140908988-140909010 AGAAATTTTACTGAGGTAGAAGG + Intronic
1000140378 5:158397546-158397568 AGAGATTTGCTTCAGGAAGACGG - Intergenic
1000632014 5:163601455-163601477 TGAAATTTGCTGGATGTGAATGG + Intergenic
1001047458 5:168385739-168385761 AGAAAATTTCTAGAGGTGGATGG + Intronic
1001173517 5:169444198-169444220 AGAAATTTGACTGAGGTAGAAGG - Intergenic
1003003887 6:2362591-2362613 AGAACTTTACTGGATGTGGATGG - Intergenic
1003238809 6:4323475-4323497 AGTAATGTGGTTGAGGGGGAGGG - Intergenic
1003355559 6:5366369-5366391 AGAAATTCGATAGAGGTAGAAGG + Intronic
1003695974 6:8406584-8406606 AGAAATTTGACTGAAGTAGAAGG + Intergenic
1003758544 6:9149635-9149657 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1007968792 6:46029742-46029764 AGTAGTTTGCTTGTGGTGAATGG - Intronic
1008245063 6:49161502-49161524 AGAAGTTTGCTGGAGGGGCAGGG - Intergenic
1008400221 6:51055027-51055049 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1008859678 6:56133930-56133952 AGAAATTTGCTGCAGGGGCAGGG + Intronic
1008997709 6:57678267-57678289 GGAAATTTTCTTGAGGCAGATGG - Intergenic
1009851725 6:69207518-69207540 AGAAATTTTACTGAGGTAGAAGG + Intronic
1009851993 6:69209402-69209424 AGAAATTTTACTGAGGTAGAAGG + Intronic
1010108069 6:72191354-72191376 AGAAATTTTACTGAGGTAGAAGG + Intronic
1010818561 6:80387959-80387981 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1010854152 6:80815906-80815928 AGAAATTTCACTGAGGTAGAAGG + Intergenic
1010884382 6:81218213-81218235 AGAAATTTGCTGCAGGGGCAGGG + Intergenic
1011136651 6:84107381-84107403 AGAAATTTCAGTGAGGTAGAAGG + Intergenic
1012029161 6:94036731-94036753 AGAAATTTGCTTAAGTTACAAGG + Intergenic
1012224160 6:96686057-96686079 AGAAGTTTGCTTCAGGGGCAAGG + Intergenic
1012342447 6:98143458-98143480 AGAAATTTGCATGAGTAAGAAGG - Intergenic
1012863291 6:104588019-104588041 GGAAACATGCTTGAGATGGAAGG - Intergenic
1014293488 6:119588724-119588746 ATAAATTTGATTTGGGTGGAAGG - Intergenic
1014416921 6:121194947-121194969 AGACATTTTACTGAGGTGGAAGG - Intronic
1014862858 6:126491684-126491706 AAAAATTAGCTGGAGGTGGTGGG - Intergenic
1015509510 6:134023968-134023990 AGAAATTTGCATGATTTGGAAGG + Intronic
1016044558 6:139467652-139467674 AGAAATCTGCTGGACGTGGTGGG + Intergenic
1016141994 6:140624441-140624463 AGAACTTTGCTTGAGGAAGTGGG - Intergenic
1016144223 6:140648959-140648981 AGAAATTTTACTGAGGTCGAAGG - Intergenic
1016593074 6:145767100-145767122 AAAAATTAACTTGAGGTGGCTGG - Intergenic
1016744627 6:147565370-147565392 AGAAAGTAGATTGAGGTGGGGGG + Exonic
1017977187 6:159368500-159368522 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1018107405 6:160502242-160502264 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1018606744 6:165605583-165605605 AGAAACTTGCTTGAGGGAAAAGG - Intronic
1018753726 6:166830414-166830436 AGAAGTATTCTGGAGGTGGATGG + Intronic
1019003071 6:168771645-168771667 AGAAATTTCACTGAGGTAGAAGG - Intergenic
1019166765 6:170102363-170102385 AGAAATTGGGTTGAGGTGAGAGG + Intergenic
1020396646 7:7725071-7725093 AGAAATTTTACTGAGGTGGAAGG - Intronic
1020710274 7:11597182-11597204 AGAAATTTTACTGAGGTAGAAGG - Intronic
1021280915 7:18717362-18717384 AAAAATTTGGTTAAGGTAGAGGG - Intronic
1021945998 7:25727991-25728013 AGACATTTTCTCAAGGTGGAAGG - Intergenic
1022607862 7:31834201-31834223 AGAAATTTGCTGCAGGGGCAGGG + Intronic
1022794384 7:33720356-33720378 AGAGATTTCCATGCGGTGGAAGG - Intergenic
1023532929 7:41177203-41177225 AGAAGTATGCTTAAGATGGAAGG + Intergenic
1024884407 7:54125086-54125108 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1025082569 7:55996363-55996385 AGAAAGGCGCTTCAGGTGGAGGG - Intronic
1025145947 7:56503825-56503847 AAAAATGTTCTGGAGGTGGATGG + Intergenic
1026833162 7:73622338-73622360 AAAAATTAGCTGGAGGTGGTGGG + Intronic
1028141670 7:87281540-87281562 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1028330277 7:89581899-89581921 AGAACTTTGCTTGTGTTGCAAGG - Intergenic
1029390004 7:100268743-100268765 AGGAATTTACTAGGGGTGGATGG + Intronic
1029968152 7:104762183-104762205 AGATATTTGCTGGAGTGGGAGGG + Intronic
1030775524 7:113530083-113530105 AGCAATTTGGATGAGGTGGGTGG - Intergenic
1031166396 7:118233091-118233113 AGAAATTTGCTTGGTAAGGATGG + Intronic
1031414310 7:121477600-121477622 AGTAATTTCCTTGAGGAGGCAGG - Intergenic
1031440761 7:121792123-121792145 TGAAATTTGCTTTAGGTGATAGG - Intergenic
1031474513 7:122205793-122205815 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1031531718 7:122885224-122885246 AGAAGTTTGTTTCAGGTGAAAGG - Intronic
1031876850 7:127151332-127151354 GGAGATTTGCTGGAGGTGGTTGG - Intronic
1033008481 7:137593112-137593134 AGAAATAAGCATGAAGTGGATGG + Intronic
1033131942 7:138752216-138752238 AAAAATTTGCTGGACGTGGTAGG + Intronic
1033986188 7:147228393-147228415 AGAAATTTCCCTGAGCAGGAAGG + Intronic
1034073669 7:148211601-148211623 AGCAACTGGCTTGAGGGGGAGGG - Intronic
1035095781 7:156353798-156353820 TGAAACTTGCTTGAGGAGGGGGG - Intergenic
1035896851 8:3412606-3412628 AGATATTTGGTTGAGGTTCAAGG + Intronic
1036028724 8:4941687-4941709 AGAGAATTGCTTGAGCTAGAGGG - Intronic
1036637931 8:10564393-10564415 AGAATTTTGCTTGGGGTGGCTGG + Intergenic
1037003427 8:13748005-13748027 AGAAATTTGCTTAAGTTGCAAGG - Intergenic
1038138975 8:24822269-24822291 AGAAATTTGCATAAGTTGCAAGG + Intergenic
1038454542 8:27664080-27664102 GGAAATTTCACTGAGGTGGAAGG + Intronic
1038606222 8:29007664-29007686 AGAAATTAGCTGGATGTGGTGGG + Intronic
1038812003 8:30856871-30856893 AGAATTTTGATTGAGATTGATGG - Intronic
1039124937 8:34191108-34191130 AGAAATTTCTTAAAGGTGGAAGG - Intergenic
1039626594 8:39060595-39060617 AGAAATTTCACTGAGGTAGAAGG + Intronic
1039843798 8:41311454-41311476 CGCATTTGGCTTGAGGTGGAGGG - Intergenic
1041986116 8:63924027-63924049 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1042001127 8:64124443-64124465 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1043257934 8:78158922-78158944 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1044793354 8:95870788-95870810 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1045943573 8:107768523-107768545 TCAAATTTGGCTGAGGTGGATGG + Intergenic
1046417711 8:113938259-113938281 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1046452794 8:114415622-114415644 AGAAGTTTGCTTCAGGGGCAGGG - Intergenic
1047539283 8:125748624-125748646 AGATATTTACATGAGGTGGGTGG + Intergenic
1048675199 8:136770276-136770298 AGAAATTTGCATAAGTTGCAAGG - Intergenic
1049490857 8:142901028-142901050 AGAAATTTCATGGAGGTAGAAGG - Intronic
1050152448 9:2630245-2630267 AGAAATTTGCTTGTCCTGAAAGG + Intronic
1050642789 9:7686157-7686179 AGAAATTTGATTAAGATGGGGGG + Intergenic
1051882076 9:21850216-21850238 AGAAATTTTACTGAGGTAGAAGG - Intronic
1052332414 9:27283224-27283246 AGAAATTAGTTTCAAGTGGAGGG - Intergenic
1052599050 9:30600380-30600402 AGAAGTTTGCTTCAGGGGCAGGG - Intergenic
1053535029 9:38916899-38916921 AGACTTTTGCTTAATGTGGATGG + Intergenic
1053783928 9:41637300-41637322 ACAAAGTTGCCTGAAGTGGATGG - Intergenic
1054171883 9:61847441-61847463 ACAAAGTTGCCTGAAGTGGATGG - Intergenic
1054207248 9:62141321-62141343 AGACTTTTGCTTAATGTGGATGG + Intergenic
1054446744 9:65376454-65376476 ACAAAGTTGCCTGAAGTGGATGG - Intergenic
1054631103 9:67447033-67447055 AGACTTTTGCTTAATGTGGATGG - Intergenic
1054665652 9:67733371-67733393 ACAAAGTTGCCTGAAGTGGATGG + Intergenic
1055878958 9:80975440-80975462 AGAGAATTGCTTGGTGTGGAAGG + Intergenic
1056092230 9:83216585-83216607 AGAAGTTTGCTGGAGGAGCAGGG + Intergenic
1058061320 9:100499659-100499681 AGAAATTTGCCTGAGGTCACAGG - Intronic
1058154994 9:101504981-101505003 AGACATTTTCTTGAGGTTGGCGG - Intronic
1058448836 9:105077620-105077642 AGAAATTTCCTTGTGGATGAAGG - Intergenic
1058734855 9:107884771-107884793 AGAAATTTGTTGGATCTGGAGGG + Intergenic
1058970197 9:110074459-110074481 TGAAATTTGCATGAGGTCTATGG + Intronic
1061738441 9:132679918-132679940 ATTTATTTGCTTGAGGTGCAGGG + Intronic
1061845348 9:133385125-133385147 AGACAACTGCTTGGGGTGGAAGG - Intronic
1203756359 Un_GL000218v1:130999-131021 ACAAATTTGATTGAGGAAGAAGG - Intergenic
1185825956 X:3249897-3249919 AGACATTTTCTCCAGGTGGAGGG + Intergenic
1185893585 X:3840496-3840518 AGAAATTTGCATAAGTAGGAAGG + Intronic
1185898700 X:3878920-3878942 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1185903817 X:3917349-3917371 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1185953947 X:4468458-4468480 AGAAATTTACTTGAGCTGGAGGG + Intergenic
1186469837 X:9812541-9812563 AGAAATTTTACTGAGGTAGAAGG + Intronic
1186514611 X:10157260-10157282 AGAAATTTGGTTAATTTGGAGGG + Intronic
1186650711 X:11556972-11556994 AGAAATTTGATTGTTGTGGTAGG - Intronic
1187550662 X:20301569-20301591 TGAAGTTTTCTTGAGGAGGAAGG + Intergenic
1187982802 X:24776928-24776950 AAAGATTTGCTTGAGTTTGAAGG - Intronic
1188214036 X:27456431-27456453 AGAAATTTTCCTGAGGTGAGAGG + Intergenic
1190145832 X:47890880-47890902 AGAAATTTCCCTGAGGTGTAAGG + Intronic
1190721798 X:53154873-53154895 AGAAATTTCACTGAGGTAGAAGG + Intergenic
1190767315 X:53486221-53486243 AGAAACTTCATTGAGGTGGCAGG + Intergenic
1190990239 X:55541056-55541078 AGAAATTTGCTGCAACTGGAGGG - Intergenic
1191617796 X:63188525-63188547 AGAAATTTTCTTGTGGAGAAAGG - Intergenic
1191658869 X:63630253-63630275 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1191742604 X:64451752-64451774 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1191759300 X:64629477-64629499 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1191769565 X:64740544-64740566 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1191779402 X:64849610-64849632 AGACATTTGTTTGTGGTGGGGGG - Intergenic
1191941324 X:66484312-66484334 AGAAATTTTACTGAGGTTGAAGG + Intergenic
1191988257 X:67005093-67005115 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1192216667 X:69164165-69164187 AGGGATGTGCTTGAGGTGGATGG + Intronic
1192297772 X:69868463-69868485 AGAAATTTTACTGAGGTAGAAGG + Intronic
1193167659 X:78300856-78300878 AGAAATTTGCTGGAGGGGCAGGG - Intronic
1193297714 X:79852245-79852267 AGAAATTTTACTGAGGTGAAAGG - Intergenic
1194330958 X:92582545-92582567 AGAAGTTTGCTTCAGGAGCAGGG + Intronic
1194406784 X:93506287-93506309 AGCAATTTCCTGGAGCTGGATGG + Intergenic
1194513483 X:94822688-94822710 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1194583398 X:95704395-95704417 AACAATGTGCTTGAAGTGGAGGG + Intergenic
1194829013 X:98597341-98597363 AGAAATTTGCATAAGGAGCAAGG - Intergenic
1194850245 X:98860098-98860120 AGAAGTTTGCTTCAGGGGCAGGG + Intergenic
1195126727 X:101815439-101815461 AGAAATTTGCTGCAGGGGCAAGG - Intergenic
1195487450 X:105425406-105425428 AGGAATTTGATTAAGGTGAATGG + Intronic
1196114529 X:111984540-111984562 AGAAATTTTACTGAGGTGGAAGG + Intronic
1196187709 X:112762357-112762379 AGAAAGCTGCCTGGGGTGGATGG + Intergenic
1197097406 X:122612391-122612413 AGAAATTTCCCTAAGGTAGAAGG - Intergenic
1197245113 X:124159442-124159464 AGAAATTTTATTGAGGTAGAAGG + Intronic
1197310423 X:124898301-124898323 AGAGATTTACTTGAAGTGGATGG + Intronic
1197372120 X:125638303-125638325 AGAAATTTCACTGAGGTAGAAGG + Intergenic
1197405024 X:126038750-126038772 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1197477432 X:126941777-126941799 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1197501447 X:127246802-127246824 TGAAGATTGCTTGAGGTGAAGGG + Intergenic
1197554321 X:127935983-127936005 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1198133041 X:133717976-133717998 AGAAATAAGGCTGAGGTGGAAGG + Intronic
1198701222 X:139399849-139399871 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1198835026 X:140795670-140795692 AGAAATTTGCTGCAGGGGCAAGG - Intergenic
1198933971 X:141887438-141887460 AGAAATTTGACTGAGGTAGAAGG - Intronic
1199627146 X:149751046-149751068 AGAAATTTTACTGAGGTAGAAGG + Intergenic
1199868773 X:151877679-151877701 AGAAGTTTGCTTCAGGGGCAGGG - Intergenic
1200639661 Y:5701611-5701633 AGAAGTTTGCTTCAGGAGCAGGG + Intronic
1202359692 Y:24094946-24094968 AGAAATTTTACTGAGGTAGAAGG - Intergenic
1202511086 Y:25575168-25575190 AGAAATTTTACTGAGGTAGAAGG + Intergenic