ID: 951411536

View in Genome Browser
Species Human (GRCh38)
Location 3:22372553-22372575
Sequence CATCCGGGAGGAGCAGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951411526_951411536 -1 Left 951411526 3:22372531-22372553 CCGCCCGGCGCCCTGGCCCTGGC 0: 1
1: 0
2: 7
3: 77
4: 694
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157
951411528_951411536 -5 Left 951411528 3:22372535-22372557 CCGGCGCCCTGGCCCTGGCATCC 0: 1
1: 0
2: 6
3: 46
4: 529
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157
951411518_951411536 29 Left 951411518 3:22372501-22372523 CCACCGAGCTCTTCATTCTCCTG 0: 1
1: 0
2: 1
3: 22
4: 233
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157
951411527_951411536 -4 Left 951411527 3:22372534-22372556 CCCGGCGCCCTGGCCCTGGCATC 0: 1
1: 0
2: 1
3: 28
4: 359
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157
951411523_951411536 10 Left 951411523 3:22372520-22372542 CCTGCTGGCGGCCGCCCGGCGCC 0: 1
1: 0
2: 1
3: 43
4: 374
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157
951411519_951411536 26 Left 951411519 3:22372504-22372526 CCGAGCTCTTCATTCTCCTGCTG 0: 1
1: 0
2: 4
3: 37
4: 457
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157
951411517_951411536 30 Left 951411517 3:22372500-22372522 CCCACCGAGCTCTTCATTCTCCT 0: 1
1: 0
2: 1
3: 16
4: 202
Right 951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951411536 Original CRISPR CATCCGGGAGGAGCAGCCGC CGG Intronic
900528331 1:3140174-3140196 CATCCGGGGGCTGCATCCGCCGG - Intronic
900987260 1:6080368-6080390 CATCCGGGAGGAGGAGGCTGGGG + Intronic
901211214 1:7527056-7527078 CAGGGGAGAGGAGCAGCCGCTGG - Intronic
901466689 1:9426255-9426277 CATCCCTGAGGAGCAGCCCCTGG - Intergenic
901823232 1:11843760-11843782 CGTCCTGGAGGAGCAGCGGATGG + Intergenic
903953672 1:27011046-27011068 AATCCTGGAGGTGCAGCAGCTGG + Intronic
905385943 1:37604314-37604336 CATACAGGAGGAGCAGCTACTGG + Intergenic
905974049 1:42162775-42162797 CAGTCGGGAGGAGCAGCCCGGGG - Exonic
905996013 1:42380970-42380992 CATCCGCGAGGACTACCCGCAGG + Exonic
911982833 1:104587139-104587161 CATCCCAGAGGAGCACCCACTGG - Intergenic
912845760 1:113073427-113073449 CGTCCCGGAGGAGCAGTTGCTGG + Exonic
914994971 1:152535563-152535585 CCTCCAGGAGGAGCTGCCACCGG + Intronic
915195026 1:154182946-154182968 CATGAGGGAGGGGCAGGCGCTGG - Intronic
916733179 1:167584270-167584292 CAGCTGTGAGGACCAGCCGCTGG - Intergenic
920436938 1:205953200-205953222 CATCTGGAAGCAGCAGCCCCAGG - Intergenic
1063047916 10:2412433-2412455 CATCCGGGAGGAAGAGAAGCAGG - Intergenic
1070850656 10:79559494-79559516 CCTCCGGCAGGAGCAGCGACTGG - Exonic
1072753168 10:97999075-97999097 CAGCAGGGAGGTGCAGCTGCAGG + Intronic
1076624941 10:131816008-131816030 CAACAGGAAGGAGCAGCTGCTGG + Intergenic
1076713585 10:132352285-132352307 CCTCCGGGTGGGGCAGGCGCAGG + Intronic
1077308025 11:1876543-1876565 CAGCCGGGTGGGGCAGCCACAGG + Intronic
1083173323 11:60935275-60935297 CATCCTGGGGGAGCAGGCGCTGG + Exonic
1083852598 11:65376932-65376954 CTTCCGGGAGGAGGGGCCCCGGG - Exonic
1084195093 11:67520038-67520060 CTTCCGGGAGGTGCGGCCACTGG - Exonic
1084199116 11:67543555-67543577 CATCCGGGCAGGGCAGCTGCAGG + Intergenic
1084218526 11:67664425-67664447 CAACCGGCAGGAGAAGCCCCTGG - Exonic
1084978083 11:72814250-72814272 CCTCCGGGAGGAGCCGCCTCCGG - Intergenic
1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG + Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1096510199 12:52123595-52123617 CTCCTGGGAGGAGCAGCCTCTGG + Intergenic
1102519137 12:113468156-113468178 CATCCGCGAGCAGCTGGCGCAGG - Exonic
1102554635 12:113718978-113719000 CCCCAGGGAGGAGCAGCCCCAGG - Intergenic
1102977970 12:117220233-117220255 CATCCTGCAGGAGCAGCTGGCGG - Exonic
1103594319 12:122014482-122014504 CACCCCGGAGGAACAGCAGCAGG + Intergenic
1105897166 13:24726264-24726286 CATGCAGGAGGAGCAGCTGCAGG + Intergenic
1107596973 13:41973321-41973343 CCTCCGGGGGGAACAGCTGCAGG + Intergenic
1113378295 13:109783536-109783558 CATCCTGGAGGAGGAGCGTCTGG - Exonic
1113411750 13:110096025-110096047 CATCCGGGTGGACCAGCATCTGG + Intergenic
1115522401 14:34246140-34246162 CACCCAGGAGGAGAAGCAGCAGG + Intronic
1118318909 14:64742058-64742080 CATCCTGGAGGAGCATGAGCTGG + Exonic
1125742038 15:41972163-41972185 CGGCCGGGAGGGGCAGCGGCGGG + Intronic
1126453484 15:48835643-48835665 CATCAGGGAGGAACAGCCCAAGG + Intronic
1129771313 15:78205059-78205081 CACCCGGGGTGAGCAGCTGCTGG - Intronic
1130017929 15:80201778-80201800 CACCTGGGAGGAGCAGCACCTGG - Intergenic
1132149168 15:99447482-99447504 CTTCAGGGACGAGGAGCCGCAGG - Intergenic
1132664139 16:1073958-1073980 CAGCCTGGAGCAGCAGCAGCAGG - Intergenic
1132748634 16:1447304-1447326 CCTCGGGGAGGGGCAGCCGGGGG - Intronic
1132809658 16:1791454-1791476 CTTCCTGGAGGAGCTGCAGCTGG - Exonic
1139405900 16:66717425-66717447 CATCCTGTAGGAGCAGCACCAGG + Intergenic
1139467059 16:67159723-67159745 CAGCTGGCTGGAGCAGCCGCCGG + Intronic
1140809825 16:78566460-78566482 AATCAGGGAGGAGAAGCCACAGG - Intronic
1141571601 16:84937317-84937339 TATGGGGGAGCAGCAGCCGCTGG - Intergenic
1142204823 16:88777952-88777974 CATGCGGGAGGGACAGACGCAGG - Intronic
1142240054 16:88940947-88940969 GATCCGGGAACGGCAGCCGCGGG + Intronic
1143463072 17:7116183-7116205 CACCAGGCAGCAGCAGCCGCTGG + Intergenic
1144488086 17:15684201-15684223 GACCGGGGAGGAGCAGACGCTGG - Exonic
1145049474 17:19648478-19648500 AATCCTGGAGGAGCAGGCGGAGG - Intronic
1146956826 17:36940836-36940858 CATCCGCGAGCAGCTGGCGCAGG + Exonic
1148438437 17:47699417-47699439 GCTCCGGGAGGAGCAGCTCCAGG + Exonic
1148779372 17:50112849-50112871 CACCCGGCAGGGGCAGCCACTGG - Exonic
1150823016 17:68450895-68450917 CATCTGGGAGGAAAAGCAGCCGG + Exonic
1151624908 17:75270728-75270750 CATCCGGGGGATGCAGCGGCGGG - Intronic
1152189538 17:78880031-78880053 CCTCCGAGAGCAGCAGCAGCCGG - Intronic
1152271060 17:79325153-79325175 CATCAGGGAGAAGCAGACGGAGG + Intronic
1152758580 17:82097321-82097343 CATGCTGGAGGAGGAGCCGGCGG - Intronic
1153372303 18:4333229-4333251 CATCTGGGATGAGCAGCCCCTGG - Intronic
1153651076 18:7240843-7240865 CATCAAGGAGGAGAAGCCACAGG + Intergenic
1153653320 18:7260763-7260785 CACCAGGGAAGAACAGCCGCTGG - Intergenic
1154496127 18:14962846-14962868 CTTCCGGGTGGAGGAGCAGCAGG + Intergenic
1161850664 19:6736612-6736634 CCTCCCGGAGGCCCAGCCGCAGG + Exonic
1161976952 19:7612401-7612423 CTTCCTGCAGGTGCAGCCGCGGG + Exonic
1162477919 19:10911987-10912009 CCTCCGGGAGGAGAAGCCCTGGG - Intronic
1163420378 19:17210738-17210760 CATCCAGGAGGAGGAGCTGGAGG + Exonic
1163690748 19:18736999-18737021 CATCCTGGAGAAGTAGCCACAGG + Intronic
1166523122 19:43494767-43494789 CATCCTGGAGCACCAGCAGCTGG + Exonic
1166669591 19:44701823-44701845 CTTCCGGGAGAAACAGCTGCTGG - Intronic
1166894688 19:46016155-46016177 CATCCCGGGAGAGCGGCCGCGGG + Exonic
1168254784 19:55159415-55159437 CGTGCGGCAGGAGCAGCTGCAGG - Exonic
926166481 2:10524429-10524451 CATGGTGGAGGAGCAGCAGCTGG + Intergenic
926185840 2:10690037-10690059 AATCCGGGAAGAGCGGCGGCCGG + Intergenic
927417846 2:22897532-22897554 CATGCGGCAGGTGCAGCAGCAGG + Intergenic
927419699 2:22917299-22917321 CATTCAGGAGGTGCAGCCTCTGG - Intergenic
927843004 2:26457159-26457181 AAGCTGAGAGGAGCAGCCGCAGG - Intergenic
927908792 2:26881580-26881602 CAGCCGGCAGGAGCAGGCACAGG + Intronic
932425517 2:71631904-71631926 CATCAGGGAGGAGGAGGCCCTGG + Intronic
932779916 2:74553623-74553645 CCTCCGGGAGGCGCTGCCCCTGG - Intronic
934735508 2:96687902-96687924 CACCCTGGCGGAGCAGCTGCAGG - Intergenic
941130975 2:161650619-161650641 CAGCCGGGAGGAACAGGAGCCGG - Intronic
942138728 2:172955890-172955912 GATCCGAGAGCAGCAGCCCCAGG - Intronic
942261686 2:174171815-174171837 CACACGGGAGGAGCCGCAGCTGG + Intronic
944451816 2:199851182-199851204 CGTCCGGGAGGCGGAGCCGGCGG - Intergenic
948398852 2:237668073-237668095 AATGCAGGAGGAGCAGCTGCTGG - Intronic
948605062 2:239129664-239129686 CCTCCAGGAGGAGCAGGAGCCGG - Intronic
948641975 2:239380932-239380954 CATCCGGGAGGCGCTGCTGAGGG - Intronic
948883331 2:240871222-240871244 CATCAGGGAGGAGTAGAGGCAGG + Intronic
948992763 2:241563155-241563177 CAGCCGGGAGCAGCAGGAGCAGG - Intronic
1170896984 20:20423470-20423492 CATCTGGAAGGAGGAGCAGCAGG + Intronic
1170998669 20:21391714-21391736 CTCCCGGGAGGGCCAGCCGCGGG - Intergenic
1172997799 20:39083768-39083790 TGCCCGGGAGGAGCAGCTGCTGG + Intergenic
1175447339 20:59032310-59032332 CAGCCGGGCGGTTCAGCCGCAGG + Exonic
1180222327 21:46366917-46366939 CATCCGTGAGGAGCACAGGCAGG + Exonic
1182548305 22:31088012-31088034 CATCCGGGAACTGCAGCGGCAGG + Exonic
1182619936 22:31613431-31613453 CCTCCTGGAGGAGCTGCCCCTGG - Exonic
1184550307 22:45200899-45200921 CTTCCTGGAGGAGATGCCGCTGG + Intronic
1184631315 22:45782489-45782511 CTTCTGGGAGGTGCAGCAGCTGG + Intronic
1185272510 22:49935644-49935666 GGTCCGGGAGGAGCAGGGGCGGG + Intergenic
951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG + Intronic
953170580 3:40503243-40503265 CATCAGGGAGGAGAATCTGCAGG - Intergenic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
954862523 3:53702692-53702714 GCTCCGGGAGAAGCAGCAGCTGG + Exonic
960760165 3:121064271-121064293 CATCGAGGAGGAGCAGAAGCAGG - Intronic
967775447 3:193381538-193381560 CTTCTGGGAGAAGCAGCCTCAGG + Intergenic
968450741 4:674894-674916 CTCCCGGGCAGAGCAGCCGCAGG - Intronic
968760995 4:2442759-2442781 CAGCTGGGAGGAGCAGCCCCCGG - Intronic
969435902 4:7189282-7189304 GTTCAGGGAGGAGCAGACGCAGG - Intergenic
983077612 4:163344302-163344324 CACCCGGGTGGAGCAGGCGCGGG + Exonic
985508524 5:298834-298856 CAGCTGGGGGGAGCAGCTGCGGG - Intronic
985573900 5:664931-664953 CATCCGGTAGGAGGAGGGGCAGG + Exonic
985587969 5:750750-750772 CATCCTGCAGGAGCAGCCCATGG - Intronic
985602638 5:843217-843239 CATCCTGCAGGAGCAGCCCATGG - Intronic
986200424 5:5573853-5573875 CATGCGAGATGGGCAGCCGCAGG + Intergenic
992240800 5:74767325-74767347 GAGCCGCCAGGAGCAGCCGCTGG - Exonic
993297045 5:86153713-86153735 CAGCAGGGAGAAGCAGCAGCTGG - Intergenic
997521754 5:134527638-134527660 GAGCCGGGAGGAGGAGCCGGAGG - Intronic
999134306 5:149307592-149307614 CATCAGGGAGGACCAGCTCCTGG + Exonic
1005589975 6:27312755-27312777 CATCCGGGCGGCACAGCCACCGG - Intergenic
1006211918 6:32403085-32403107 CATCCGGGGAGAGAAGCTGCTGG - Exonic
1006255524 6:32829438-32829460 CATCCAGGATGAGGACCCGCGGG + Exonic
1007954249 6:45901952-45901974 AATCAGGCAGGAGCAGCTGCTGG + Exonic
1008531599 6:52466271-52466293 CAAGCAAGAGGAGCAGCCGCTGG - Intronic
1012624970 6:101393773-101393795 CCTCGGGGAGGAGCAGCCGGAGG - Intergenic
1018247120 6:161834070-161834092 CATCGTGTAAGAGCAGCCGCTGG + Intronic
1018895833 6:168016442-168016464 ATGCCGGGAGGAGCAGCCGGTGG - Intronic
1018899532 6:168044227-168044249 CCTCCGGGAGGGTCAGCAGCCGG - Intronic
1018899556 6:168044310-168044332 CCTCCGGGAGGGTCAGCAGCCGG - Intronic
1018899631 6:168044565-168044587 CCTCCGGGAGGGTCAGCAGCCGG - Intronic
1018942760 6:168319943-168319965 CAGCCGGGAGGAGGAGCCCGGGG + Intergenic
1019482825 7:1274298-1274320 CGTACGGGAGGAGAAGCCCCTGG + Intergenic
1019542993 7:1559821-1559843 CAGCCAGGAGGAGCAGGCCCTGG + Intronic
1025035467 7:55590510-55590532 CATCCTGGAGGAGAAGGCACAGG - Intergenic
1029372539 7:100158588-100158610 CAGCCGGGCGCAGCAGCCGGAGG - Exonic
1029686716 7:102153485-102153507 CTTCCGGGAGCAGCAGCAACAGG - Intronic
1030127595 7:106169197-106169219 CAACCGGCAGGAGCATCAGCTGG + Intergenic
1032087370 7:128891149-128891171 CCCCAGGGAGGAGCAGCCGAGGG + Intronic
1032872300 7:135999319-135999341 CATTCTGTAGGAGCAGCAGCTGG + Intergenic
1034800480 7:154052651-154052673 CGCGCGGGAGGAGCGGCCGCCGG + Intronic
1037820652 8:22133280-22133302 CCCCCGGGCGGAGCAGCCCCCGG + Intronic
1037824809 8:22154876-22154898 CACCCGGGAGGACCAGGAGCTGG - Intronic
1037877484 8:22555051-22555073 CAAGCGGGAGGGGCAGCAGCTGG + Intronic
1039466438 8:37788357-37788379 CATCAGGGAGCAGCAGCCATCGG + Intronic
1041588429 8:59547422-59547444 CATCAGGGAGGCTCAGCCGCAGG - Intergenic
1043407850 8:79956995-79957017 CATGCGGCAGGAGCAGCAGCGGG - Intronic
1048259842 8:132936300-132936322 AGCCCGGGAGGAGCAGCTGCTGG - Intronic
1049734900 8:144199669-144199691 CATCCTGGAGGGGCAGCAGATGG + Intronic
1049767057 8:144359732-144359754 CATCCGGGTGGTGCAGGTGCTGG + Exonic
1050336082 9:4591145-4591167 CATCCTGGAAGGGCAGTCGCTGG + Intronic
1050395896 9:5195422-5195444 CATCCAGGAGGAGCTTCTGCAGG - Intergenic
1052210867 9:25901766-25901788 CATCAGTGAGGAGCAGGCTCTGG + Intergenic
1056756106 9:89382968-89382990 CATCCGGGAGAAGCGGAAGCTGG - Intronic
1057304829 9:93905953-93905975 CGTCGGGGAGGAGCATCCTCGGG - Intergenic
1058905273 9:109477722-109477744 CATCAGGTAGGAGCGGCCCCAGG - Intronic
1062338358 9:136082358-136082380 CATCCCGGAGGCCCATCCGCCGG - Intronic
1062449432 9:136609325-136609347 CACCCTGGAGGGGCAGCTGCAGG - Intergenic
1062513539 9:136921028-136921050 CACCCGGCAGGTGCAGCAGCTGG + Exonic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1203791085 EBV:151894-151916 CACCCAGGAAGAGCAGCGGCAGG + Intergenic
1188811403 X:34657293-34657315 GAGCCGGGAGGAGCGGGCGCGGG - Intergenic
1198190236 X:134296774-134296796 CATCCTGGGGGAGAAGCCTCAGG - Intergenic
1198321389 X:135521513-135521535 GACCGGGGAGGAGCAGCCCCGGG + Intronic
1200116034 X:153770106-153770128 CATCCAGGATGGGCAGCCGGGGG - Exonic