ID: 951416012

View in Genome Browser
Species Human (GRCh38)
Location 3:22422337-22422359
Sequence CTGCTTTTGTGTAGAAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416012_951416015 12 Left 951416012 3:22422337-22422359 CCAACTTTTCTACACAAAAGCAG No data
Right 951416015 3:22422372-22422394 TGTGATGTTAAGAAATTTCCAGG No data
951416012_951416016 13 Left 951416012 3:22422337-22422359 CCAACTTTTCTACACAAAAGCAG No data
Right 951416016 3:22422373-22422395 GTGATGTTAAGAAATTTCCAGGG No data
951416012_951416019 30 Left 951416012 3:22422337-22422359 CCAACTTTTCTACACAAAAGCAG No data
Right 951416019 3:22422390-22422412 CCAGGGCTCATCTAGACTGGAGG No data
951416012_951416017 27 Left 951416012 3:22422337-22422359 CCAACTTTTCTACACAAAAGCAG No data
Right 951416017 3:22422387-22422409 TTTCCAGGGCTCATCTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416012 Original CRISPR CTGCTTTTGTGTAGAAAAGT TGG (reversed) Intergenic