ID: 951416014

View in Genome Browser
Species Human (GRCh38)
Location 3:22422369-22422391
Sequence GGAAATTTCTTAACATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416014_951416020 -1 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416020 3:22422391-22422413 CAGGGCTCATCTAGACTGGAGGG No data
951416014_951416019 -2 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416019 3:22422390-22422412 CCAGGGCTCATCTAGACTGGAGG No data
951416014_951416017 -5 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416017 3:22422387-22422409 TTTCCAGGGCTCATCTAGACTGG No data
951416014_951416021 26 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416021 3:22422418-22422440 CTCACTCAGATGTGCTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416014 Original CRISPR GGAAATTTCTTAACATCACA AGG (reversed) Intergenic