ID: 951416017

View in Genome Browser
Species Human (GRCh38)
Location 3:22422387-22422409
Sequence TTTCCAGGGCTCATCTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416014_951416017 -5 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416017 3:22422387-22422409 TTTCCAGGGCTCATCTAGACTGG No data
951416012_951416017 27 Left 951416012 3:22422337-22422359 CCAACTTTTCTACACAAAAGCAG No data
Right 951416017 3:22422387-22422409 TTTCCAGGGCTCATCTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416017 Original CRISPR TTTCCAGGGCTCATCTAGAC TGG Intergenic