ID: 951416019

View in Genome Browser
Species Human (GRCh38)
Location 3:22422390-22422412
Sequence CCAGGGCTCATCTAGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416012_951416019 30 Left 951416012 3:22422337-22422359 CCAACTTTTCTACACAAAAGCAG No data
Right 951416019 3:22422390-22422412 CCAGGGCTCATCTAGACTGGAGG No data
951416014_951416019 -2 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416019 3:22422390-22422412 CCAGGGCTCATCTAGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416019 Original CRISPR CCAGGGCTCATCTAGACTGG AGG Intergenic