ID: 951416020

View in Genome Browser
Species Human (GRCh38)
Location 3:22422391-22422413
Sequence CAGGGCTCATCTAGACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416014_951416020 -1 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416020 3:22422391-22422413 CAGGGCTCATCTAGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416020 Original CRISPR CAGGGCTCATCTAGACTGGA GGG Intergenic
No off target data available for this crispr