ID: 951416021

View in Genome Browser
Species Human (GRCh38)
Location 3:22422418-22422440
Sequence CTCACTCAGATGTGCTAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416014_951416021 26 Left 951416014 3:22422369-22422391 CCTTGTGATGTTAAGAAATTTCC No data
Right 951416021 3:22422418-22422440 CTCACTCAGATGTGCTAAAACGG No data
951416018_951416021 5 Left 951416018 3:22422390-22422412 CCAGGGCTCATCTAGACTGGAGG No data
Right 951416021 3:22422418-22422440 CTCACTCAGATGTGCTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416021 Original CRISPR CTCACTCAGATGTGCTAAAA CGG Intergenic