ID: 951416327

View in Genome Browser
Species Human (GRCh38)
Location 3:22426801-22426823
Sequence GTTCTATCACTTATGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951416327_951416329 16 Left 951416327 3:22426801-22426823 CCTTGCTCCATAAGTGATAGAAC No data
Right 951416329 3:22426840-22426862 TAAGCAAAGATATAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951416327 Original CRISPR GTTCTATCACTTATGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr