ID: 951421100

View in Genome Browser
Species Human (GRCh38)
Location 3:22486019-22486041
Sequence CATTCTGTGCTACTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951421098_951421100 0 Left 951421098 3:22485996-22486018 CCAAGATACATCAGCAGGATAGA No data
Right 951421100 3:22486019-22486041 CATTCTGTGCTACTTGTACAGGG No data
951421096_951421100 25 Left 951421096 3:22485971-22485993 CCTATATTCTACAATTTCAATTG No data
Right 951421100 3:22486019-22486041 CATTCTGTGCTACTTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951421100 Original CRISPR CATTCTGTGCTACTTGTACA GGG Intergenic
No off target data available for this crispr