ID: 951427895

View in Genome Browser
Species Human (GRCh38)
Location 3:22569843-22569865
Sequence AGTCCTGTAGCATTGACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951427895_951427896 -6 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427896 3:22569860-22569882 AGGACTCTGAACTTGTCCTCAGG No data
951427895_951427898 2 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427898 3:22569868-22569890 GAACTTGTCCTCAGGCAACAGGG No data
951427895_951427901 14 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427901 3:22569880-22569902 AGGCAACAGGGTGCTGGCAAAGG No data
951427895_951427899 8 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427899 3:22569874-22569896 GTCCTCAGGCAACAGGGTGCTGG No data
951427895_951427897 1 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427897 3:22569867-22569889 TGAACTTGTCCTCAGGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951427895 Original CRISPR AGTCCTGTAGCATTGACAGT TGG (reversed) Intergenic
No off target data available for this crispr