ID: 951427896

View in Genome Browser
Species Human (GRCh38)
Location 3:22569860-22569882
Sequence AGGACTCTGAACTTGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951427889_951427896 27 Left 951427889 3:22569810-22569832 CCACACTGTGCTGAAGACTGGAA No data
Right 951427896 3:22569860-22569882 AGGACTCTGAACTTGTCCTCAGG No data
951427894_951427896 -5 Left 951427894 3:22569842-22569864 CCCAACTGTCAATGCTACAGGAC No data
Right 951427896 3:22569860-22569882 AGGACTCTGAACTTGTCCTCAGG No data
951427895_951427896 -6 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427896 3:22569860-22569882 AGGACTCTGAACTTGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951427896 Original CRISPR AGGACTCTGAACTTGTCCTC AGG Intergenic
No off target data available for this crispr