ID: 951427898

View in Genome Browser
Species Human (GRCh38)
Location 3:22569868-22569890
Sequence GAACTTGTCCTCAGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951427894_951427898 3 Left 951427894 3:22569842-22569864 CCCAACTGTCAATGCTACAGGAC No data
Right 951427898 3:22569868-22569890 GAACTTGTCCTCAGGCAACAGGG No data
951427895_951427898 2 Left 951427895 3:22569843-22569865 CCAACTGTCAATGCTACAGGACT No data
Right 951427898 3:22569868-22569890 GAACTTGTCCTCAGGCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951427898 Original CRISPR GAACTTGTCCTCAGGCAACA GGG Intergenic
No off target data available for this crispr