ID: 951437096

View in Genome Browser
Species Human (GRCh38)
Location 3:22677188-22677210
Sequence AGGGATAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951437096_951437106 27 Left 951437096 3:22677188-22677210 CCCACAATCACTGTGCTATCCCT No data
Right 951437106 3:22677238-22677260 TGCCATGTGGCTGCTGATGAGGG No data
951437096_951437105 26 Left 951437096 3:22677188-22677210 CCCACAATCACTGTGCTATCCCT No data
Right 951437105 3:22677237-22677259 ATGCCATGTGGCTGCTGATGAGG No data
951437096_951437103 14 Left 951437096 3:22677188-22677210 CCCACAATCACTGTGCTATCCCT No data
Right 951437103 3:22677225-22677247 GATTCTCTCTCCATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951437096 Original CRISPR AGGGATAGCACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr