ID: 951440176

View in Genome Browser
Species Human (GRCh38)
Location 3:22713564-22713586
Sequence AGGTGAACAATCCTGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440176_951440179 -3 Left 951440176 3:22713564-22713586 CCCATTTTCAGGATTGTTCACCT No data
Right 951440179 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
951440176_951440181 30 Left 951440176 3:22713564-22713586 CCCATTTTCAGGATTGTTCACCT No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440176 Original CRISPR AGGTGAACAATCCTGAAAAT GGG (reversed) Intergenic
No off target data available for this crispr