ID: 951440177

View in Genome Browser
Species Human (GRCh38)
Location 3:22713565-22713587
Sequence GAGGTGAACAATCCTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440177_951440179 -4 Left 951440177 3:22713565-22713587 CCATTTTCAGGATTGTTCACCTC No data
Right 951440179 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
951440177_951440181 29 Left 951440177 3:22713565-22713587 CCATTTTCAGGATTGTTCACCTC No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440177 Original CRISPR GAGGTGAACAATCCTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr