ID: 951440179

View in Genome Browser
Species Human (GRCh38)
Location 3:22713584-22713606
Sequence CCTCCAGAGACTGATGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440176_951440179 -3 Left 951440176 3:22713564-22713586 CCCATTTTCAGGATTGTTCACCT No data
Right 951440179 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
951440177_951440179 -4 Left 951440177 3:22713565-22713587 CCATTTTCAGGATTGTTCACCTC No data
Right 951440179 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
951440173_951440179 15 Left 951440173 3:22713546-22713568 CCTCATACAATTTCATGCCCCAT No data
Right 951440179 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
951440175_951440179 -2 Left 951440175 3:22713563-22713585 CCCCATTTTCAGGATTGTTCACC No data
Right 951440179 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440179 Original CRISPR CCTCCAGAGACTGATGAGTG TGG Intergenic
No off target data available for this crispr