ID: 951440180

View in Genome Browser
Species Human (GRCh38)
Location 3:22713587-22713609
Sequence TCTCCACACTCATCAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440180_951440183 23 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440183 3:22713633-22713655 ATGTAGGTTCTTCAGGTGTTTGG No data
951440180_951440182 16 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440182 3:22713626-22713648 TGTGTTAATGTAGGTTCTTCAGG No data
951440180_951440181 7 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data
951440180_951440184 24 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440184 3:22713634-22713656 TGTAGGTTCTTCAGGTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440180 Original CRISPR TCTCCACACTCATCAGTCTC TGG (reversed) Intergenic
No off target data available for this crispr