ID: 951440181

View in Genome Browser
Species Human (GRCh38)
Location 3:22713617-22713639
Sequence TCAAAGAGCTGTGTTAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440177_951440181 29 Left 951440177 3:22713565-22713587 CCATTTTCAGGATTGTTCACCTC No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data
951440178_951440181 10 Left 951440178 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data
951440176_951440181 30 Left 951440176 3:22713564-22713586 CCCATTTTCAGGATTGTTCACCT No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data
951440180_951440181 7 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440181 3:22713617-22713639 TCAAAGAGCTGTGTTAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440181 Original CRISPR TCAAAGAGCTGTGTTAATGT AGG Intergenic
No off target data available for this crispr