ID: 951440182

View in Genome Browser
Species Human (GRCh38)
Location 3:22713626-22713648
Sequence TGTGTTAATGTAGGTTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440178_951440182 19 Left 951440178 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
Right 951440182 3:22713626-22713648 TGTGTTAATGTAGGTTCTTCAGG No data
951440180_951440182 16 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440182 3:22713626-22713648 TGTGTTAATGTAGGTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440182 Original CRISPR TGTGTTAATGTAGGTTCTTC AGG Intergenic
No off target data available for this crispr