ID: 951440183

View in Genome Browser
Species Human (GRCh38)
Location 3:22713633-22713655
Sequence ATGTAGGTTCTTCAGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440180_951440183 23 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440183 3:22713633-22713655 ATGTAGGTTCTTCAGGTGTTTGG No data
951440178_951440183 26 Left 951440178 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
Right 951440183 3:22713633-22713655 ATGTAGGTTCTTCAGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440183 Original CRISPR ATGTAGGTTCTTCAGGTGTT TGG Intergenic
No off target data available for this crispr