ID: 951440184

View in Genome Browser
Species Human (GRCh38)
Location 3:22713634-22713656
Sequence TGTAGGTTCTTCAGGTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951440180_951440184 24 Left 951440180 3:22713587-22713609 CCAGAGACTGATGAGTGTGGAGA No data
Right 951440184 3:22713634-22713656 TGTAGGTTCTTCAGGTGTTTGGG No data
951440178_951440184 27 Left 951440178 3:22713584-22713606 CCTCCAGAGACTGATGAGTGTGG No data
Right 951440184 3:22713634-22713656 TGTAGGTTCTTCAGGTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951440184 Original CRISPR TGTAGGTTCTTCAGGTGTTT GGG Intergenic
No off target data available for this crispr