ID: 951442924

View in Genome Browser
Species Human (GRCh38)
Location 3:22743453-22743475
Sequence CAATACTGCGCTTTTCCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442924_951442936 29 Left 951442924 3:22743453-22743475 CCCTTCGGAAAAGCGCAGTATTG No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data
951442924_951442931 3 Left 951442924 3:22743453-22743475 CCCTTCGGAAAAGCGCAGTATTG No data
Right 951442931 3:22743479-22743501 TGGGAGTGACCCGATTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442924 Original CRISPR CAATACTGCGCTTTTCCGAA GGG (reversed) Intergenic