ID: 951442925

View in Genome Browser
Species Human (GRCh38)
Location 3:22743454-22743476
Sequence CCAATACTGCGCTTTTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442925_951442931 2 Left 951442925 3:22743454-22743476 CCTTCGGAAAAGCGCAGTATTGG No data
Right 951442931 3:22743479-22743501 TGGGAGTGACCCGATTTTCCAGG No data
951442925_951442936 28 Left 951442925 3:22743454-22743476 CCTTCGGAAAAGCGCAGTATTGG No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442925 Original CRISPR CCAATACTGCGCTTTTCCGA AGG (reversed) Intergenic