ID: 951442925 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:22743454-22743476 |
| Sequence | CCAATACTGCGCTTTTCCGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 951442925_951442931 | 2 | Left | 951442925 | 3:22743454-22743476 | CCTTCGGAAAAGCGCAGTATTGG | No data | ||
| Right | 951442931 | 3:22743479-22743501 | TGGGAGTGACCCGATTTTCCAGG | No data | ||||
| 951442925_951442936 | 28 | Left | 951442925 | 3:22743454-22743476 | CCTTCGGAAAAGCGCAGTATTGG | No data | ||
| Right | 951442936 | 3:22743505-22743527 | CGTCTGTCACCCCATTGACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 951442925 | Original CRISPR | CCAATACTGCGCTTTTCCGA AGG (reversed) | Intergenic | ||