ID: 951442932

View in Genome Browser
Species Human (GRCh38)
Location 3:22743488-22743510
Sequence CAGACGGCACCTGGAAAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5415
Summary {0: 851, 1: 1822, 2: 1444, 3: 755, 4: 543}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442932_951442938 0 Left 951442932 3:22743488-22743510 CCCGATTTTCCAGGTGCCGTCTG 0: 851
1: 1822
2: 1444
3: 755
4: 543
Right 951442938 3:22743511-22743533 TCACCCCATTGACTAGGAAAGGG No data
951442932_951442936 -6 Left 951442932 3:22743488-22743510 CCCGATTTTCCAGGTGCCGTCTG 0: 851
1: 1822
2: 1444
3: 755
4: 543
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data
951442932_951442937 -1 Left 951442932 3:22743488-22743510 CCCGATTTTCCAGGTGCCGTCTG 0: 851
1: 1822
2: 1444
3: 755
4: 543
Right 951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442932 Original CRISPR CAGACGGCACCTGGAAAATC GGG (reversed) Intergenic
Too many off-targets to display for this crispr