ID: 951442933

View in Genome Browser
Species Human (GRCh38)
Location 3:22743489-22743511
Sequence ACAGACGGCACCTGGAAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442933_951442936 -7 Left 951442933 3:22743489-22743511 CCGATTTTCCAGGTGCCGTCTGT No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data
951442933_951442937 -2 Left 951442933 3:22743489-22743511 CCGATTTTCCAGGTGCCGTCTGT No data
Right 951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG No data
951442933_951442938 -1 Left 951442933 3:22743489-22743511 CCGATTTTCCAGGTGCCGTCTGT No data
Right 951442938 3:22743511-22743533 TCACCCCATTGACTAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442933 Original CRISPR ACAGACGGCACCTGGAAAAT CGG (reversed) Intergenic