ID: 951442934

View in Genome Browser
Species Human (GRCh38)
Location 3:22743497-22743519
Sequence ATGGGGTGACAGACGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442934_951442945 24 Left 951442934 3:22743497-22743519 CCAGGTGCCGTCTGTCACCCCAT No data
Right 951442945 3:22743544-22743566 CCCCTTGCGCTTCCCGAGTGAGG No data
951442934_951442937 -10 Left 951442934 3:22743497-22743519 CCAGGTGCCGTCTGTCACCCCAT No data
Right 951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG No data
951442934_951442938 -9 Left 951442934 3:22743497-22743519 CCAGGTGCCGTCTGTCACCCCAT No data
Right 951442938 3:22743511-22743533 TCACCCCATTGACTAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442934 Original CRISPR ATGGGGTGACAGACGGCACC TGG (reversed) Intergenic