ID: 951442936

View in Genome Browser
Species Human (GRCh38)
Location 3:22743505-22743527
Sequence CGTCTGTCACCCCATTGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442932_951442936 -6 Left 951442932 3:22743488-22743510 CCCGATTTTCCAGGTGCCGTCTG No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data
951442933_951442936 -7 Left 951442933 3:22743489-22743511 CCGATTTTCCAGGTGCCGTCTGT No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data
951442924_951442936 29 Left 951442924 3:22743453-22743475 CCCTTCGGAAAAGCGCAGTATTG No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data
951442925_951442936 28 Left 951442925 3:22743454-22743476 CCTTCGGAAAAGCGCAGTATTGG No data
Right 951442936 3:22743505-22743527 CGTCTGTCACCCCATTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442936 Original CRISPR CGTCTGTCACCCCATTGACT AGG Intergenic