ID: 951442937

View in Genome Browser
Species Human (GRCh38)
Location 3:22743510-22743532
Sequence GTCACCCCATTGACTAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442932_951442937 -1 Left 951442932 3:22743488-22743510 CCCGATTTTCCAGGTGCCGTCTG 0: 851
1: 1822
2: 1444
3: 755
4: 543
Right 951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG No data
951442933_951442937 -2 Left 951442933 3:22743489-22743511 CCGATTTTCCAGGTGCCGTCTGT 0: 857
1: 1702
2: 1055
3: 528
4: 365
Right 951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG No data
951442934_951442937 -10 Left 951442934 3:22743497-22743519 CCAGGTGCCGTCTGTCACCCCAT No data
Right 951442937 3:22743510-22743532 GTCACCCCATTGACTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442937 Original CRISPR GTCACCCCATTGACTAGGAA AGG Intergenic
No off target data available for this crispr