ID: 951442938

View in Genome Browser
Species Human (GRCh38)
Location 3:22743511-22743533
Sequence TCACCCCATTGACTAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951442932_951442938 0 Left 951442932 3:22743488-22743510 CCCGATTTTCCAGGTGCCGTCTG No data
Right 951442938 3:22743511-22743533 TCACCCCATTGACTAGGAAAGGG No data
951442933_951442938 -1 Left 951442933 3:22743489-22743511 CCGATTTTCCAGGTGCCGTCTGT No data
Right 951442938 3:22743511-22743533 TCACCCCATTGACTAGGAAAGGG No data
951442934_951442938 -9 Left 951442934 3:22743497-22743519 CCAGGTGCCGTCTGTCACCCCAT No data
Right 951442938 3:22743511-22743533 TCACCCCATTGACTAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951442938 Original CRISPR TCACCCCATTGACTAGGAAA GGG Intergenic