ID: 951444170

View in Genome Browser
Species Human (GRCh38)
Location 3:22757723-22757745
Sequence CTCTTTCTGATCAGATTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951444170_951444172 -10 Left 951444170 3:22757723-22757745 CCCGAGAATCTGATCAGAAAGAG No data
Right 951444172 3:22757736-22757758 TCAGAAAGAGAGTGAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951444170 Original CRISPR CTCTTTCTGATCAGATTCTC GGG (reversed) Intergenic
No off target data available for this crispr