ID: 951448474

View in Genome Browser
Species Human (GRCh38)
Location 3:22809997-22810019
Sequence GTGTAGGACAAGTAGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951448474_951448476 -2 Left 951448474 3:22809997-22810019 CCTCTCAGCTACTTGTCCTACAC No data
Right 951448476 3:22810018-22810040 ACATTCCCTTCCTCTCACTCTGG No data
951448474_951448480 12 Left 951448474 3:22809997-22810019 CCTCTCAGCTACTTGTCCTACAC No data
Right 951448480 3:22810032-22810054 TCACTCTGGAACTGCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951448474 Original CRISPR GTGTAGGACAAGTAGCTGAG AGG (reversed) Intergenic
No off target data available for this crispr