ID: 951449538

View in Genome Browser
Species Human (GRCh38)
Location 3:22820761-22820783
Sequence AAAACCGTGTTGGCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951449538_951449541 23 Left 951449538 3:22820761-22820783 CCAGGAACAGCCAACACGGTTTT No data
Right 951449541 3:22820807-22820829 AACTTGTTCTTCAAAATATAAGG No data
951449538_951449540 -3 Left 951449538 3:22820761-22820783 CCAGGAACAGCCAACACGGTTTT No data
Right 951449540 3:22820781-22820803 TTTGAACAAGTCAAATGAGATGG No data
951449538_951449542 24 Left 951449538 3:22820761-22820783 CCAGGAACAGCCAACACGGTTTT No data
Right 951449542 3:22820808-22820830 ACTTGTTCTTCAAAATATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951449538 Original CRISPR AAAACCGTGTTGGCTGTTCC TGG (reversed) Intergenic
No off target data available for this crispr