ID: 951451385

View in Genome Browser
Species Human (GRCh38)
Location 3:22843196-22843218
Sequence AACTGAAGATATTTAGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951451382_951451385 19 Left 951451382 3:22843154-22843176 CCAGAGAAGAAAGTGGAAAGACA No data
Right 951451385 3:22843196-22843218 AACTGAAGATATTTAGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951451385 Original CRISPR AACTGAAGATATTTAGTATA AGG Intergenic
No off target data available for this crispr