ID: 951452796

View in Genome Browser
Species Human (GRCh38)
Location 3:22858372-22858394
Sequence TTTGATGTGCAGGTTGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951452796_951452799 -8 Left 951452796 3:22858372-22858394 CCATCTACAACCTGCACATCAAA No data
Right 951452799 3:22858387-22858409 ACATCAAAAAAATAAAATGAGGG No data
951452796_951452801 16 Left 951452796 3:22858372-22858394 CCATCTACAACCTGCACATCAAA No data
Right 951452801 3:22858411-22858433 CTCAAAACTGCTGATCCCCAAGG No data
951452796_951452798 -9 Left 951452796 3:22858372-22858394 CCATCTACAACCTGCACATCAAA No data
Right 951452798 3:22858386-22858408 CACATCAAAAAAATAAAATGAGG No data
951452796_951452800 -7 Left 951452796 3:22858372-22858394 CCATCTACAACCTGCACATCAAA No data
Right 951452800 3:22858388-22858410 CATCAAAAAAATAAAATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951452796 Original CRISPR TTTGATGTGCAGGTTGTAGA TGG (reversed) Intergenic
No off target data available for this crispr