ID: 951457102

View in Genome Browser
Species Human (GRCh38)
Location 3:22904831-22904853
Sequence AACACCCCCATCATGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951457101_951457102 9 Left 951457101 3:22904799-22904821 CCTGACGTAGAGATCTGGTATGA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 951457102 3:22904831-22904853 AACACCCCCATCATGTTTTGTGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951457102 Original CRISPR AACACCCCCATCATGTTTTG TGG Intergenic
904846894 1:33426568-33426590 AACTCATCCACCATGTTTTGAGG - Intronic
908861913 1:68498787-68498809 TACACCCCAATCAGGATTTGGGG - Intergenic
915088548 1:153405510-153405532 AACATCCCCATCATATCCTGCGG + Intergenic
915096345 1:153465322-153465344 AACATCCCCATCATATCCTGCGG - Intergenic
915831641 1:159136705-159136727 AACACTGCAATCATGTTTTCTGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920290933 1:204922710-204922732 TACTCCCCCTTCATGATTTGTGG - Intronic
921581109 1:216897678-216897700 AACACCACCATCCTGTATTTTGG - Intronic
1064548241 10:16472666-16472688 TTCTCCCCCACCATGTTTTGGGG + Intronic
1065384463 10:25120542-25120564 CCCACCCCCATCATGTTTCAAGG + Intergenic
1066122265 10:32300829-32300851 CACACCACCATCATTTTTTTTGG + Intronic
1074413557 10:113247829-113247851 AGCACCCCCATCCTGATGTGTGG + Intergenic
1074846479 10:117403376-117403398 CCCACCCCCATAATCTTTTGAGG - Intergenic
1075438083 10:122460039-122460061 ATCACCCCCCGCATTTTTTGTGG + Intergenic
1081396094 11:42588030-42588052 AACACCCCCAGCAAGGTCTGGGG - Intergenic
1085193224 11:74647308-74647330 AACACTCCTATCAGGTTTTATGG - Intronic
1095564228 12:43602186-43602208 AACACACCCTTCATGTTCTGTGG - Intergenic
1098817236 12:75182709-75182731 AACACCTCCAGCAGGGTTTGGGG + Intronic
1099019896 12:77390460-77390482 AACAACTTCATCCTGTTTTGGGG - Intergenic
1102450293 12:113037006-113037028 AACACCACCATCCTCCTTTGGGG + Intergenic
1103549881 12:121729113-121729135 AACATCCCCATAGTTTTTTGCGG - Intronic
1104697512 12:130874638-130874660 AACATCCCCATTGTGTTGTGTGG + Exonic
1105637749 13:22231785-22231807 AAAGCCCTCATCATGCTTTGTGG + Intergenic
1107550116 13:41466007-41466029 ATCACCCCCTTCCTGTATTGGGG + Intronic
1109110618 13:58314482-58314504 GACACCCCCAGGATGTTTGGTGG + Intergenic
1109428713 13:62202880-62202902 AAAACCACCACCAGGTTTTGTGG - Intergenic
1110367267 13:74700906-74700928 GACACCCCAATCATTTTGTGTGG - Intergenic
1111135211 13:84032903-84032925 ATCTCCCCCATCATCTTTTCTGG + Intergenic
1118460684 14:65984253-65984275 AACATCCCCACCATGTCTTGAGG - Intronic
1120040313 14:79745564-79745586 AGCAGACCCATCATGTCTTGTGG - Intronic
1120674641 14:87406938-87406960 AATACTTCCATCATGTTCTGGGG - Intergenic
1121729424 14:96176002-96176024 ACCACCCCCATCATGGTTCTTGG - Intergenic
1124170491 15:27368278-27368300 CACACCTCCATCATGTTTCCTGG - Intronic
1127533542 15:59868279-59868301 AACACCCCCAACAGGGTATGTGG + Intergenic
1127567933 15:60211727-60211749 TACAACCCCCTGATGTTTTGTGG - Intergenic
1128412112 15:67410133-67410155 AAAACACCCATCATGGGTTGTGG + Intronic
1131738188 15:95357063-95357085 AACACCTCGATGATGTTTTTAGG + Intergenic
1132389100 15:101425880-101425902 AACACCTGCATCATGGATTGCGG - Intronic
1137540031 16:49355805-49355827 AGCACCCCAATCCTGATTTGGGG + Intergenic
1141734362 16:85842362-85842384 AGCACCCCCAACAAGCTTTGGGG + Intergenic
1143650116 17:8258124-8258146 ATCAAGCCCATCATGTTTAGTGG + Exonic
1144414177 17:15030861-15030883 AACACCCCCATGAAGCTCTGAGG + Intergenic
1149364495 17:55928697-55928719 AACACCCCCATCTAGGTCTGGGG - Intergenic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1166271307 19:41715921-41715943 AGCACTGACATCATGTTTTGAGG + Intronic
1167908288 19:52680443-52680465 GACTCCTCCATGATGTTTTGTGG - Intronic
926624901 2:15082984-15083006 TTCCCCCCCACCATGTTTTGGGG + Intergenic
926631441 2:15140090-15140112 AACACAACCACCATGTTGTGAGG + Intergenic
929799047 2:45083784-45083806 AACATCACCATCATGTTTGGGGG + Intergenic
930551339 2:52838595-52838617 AACAGCCCCAATATGTTTTTAGG - Intergenic
931745078 2:65284826-65284848 AACATCACCATCCAGTTTTGTGG - Intergenic
932590105 2:73060248-73060270 CATATCCCCATCATTTTTTGGGG - Intronic
936062667 2:109305776-109305798 ACCACCTCCAGCAAGTTTTGTGG - Intronic
936683126 2:114797937-114797959 AACATCTCCAGCATGTTATGTGG + Intronic
938420109 2:131138866-131138888 AACACCCCCATCCTGCTGGGTGG - Intronic
938873752 2:135510736-135510758 AACAGGCCCATCATGTTCAGAGG - Intronic
940051690 2:149471656-149471678 AACAACTCCATCCTGGTTTGGGG - Exonic
941013183 2:160324499-160324521 AACACACCCATTGTGTTTTCAGG - Intronic
941921205 2:170852736-170852758 AGCACGCCCATCATCTTGTGAGG - Exonic
945611132 2:212004647-212004669 AAAAAACCCATCATCTTTTGAGG + Intronic
1172113098 20:32559027-32559049 AACAGCCCCATCATGTGATCTGG - Intronic
1173952531 20:47004850-47004872 AACACCCCCATTTTTCTTTGGGG - Intronic
1174328452 20:49798411-49798433 AACATCACCATCATCCTTTGGGG + Intergenic
1174997523 20:55586978-55587000 AACACCCCTAGCATCTTCTGTGG + Intergenic
1175425427 20:58862123-58862145 AAAACCCAAAACATGTTTTGGGG - Intronic
1177096543 21:16842363-16842385 CACACACCCCTCTTGTTTTGGGG + Intergenic
1178624946 21:34207190-34207212 AAAATCCCCATCATGTTCTTAGG - Intergenic
1181010944 22:20040400-20040422 AACAGCCCCAGCCTGGTTTGGGG + Intronic
1181099669 22:20530889-20530911 AACACCTCCGCCATGTGTTGAGG - Intronic
949157919 3:849899-849921 AACTCCCCCACCATCTTTGGGGG + Intergenic
951457102 3:22904831-22904853 AACACCCCCATCATGTTTTGTGG + Intergenic
951980894 3:28565632-28565654 AACACAGCCACCATGTTGTGAGG + Intergenic
952745646 3:36775245-36775267 AACACCCCAATCTTTTCTTGTGG - Intergenic
954238219 3:49273427-49273449 AACACCACCACCACTTTTTGGGG - Intronic
955575010 3:60351636-60351658 AACACCACCATGATGTGGTGAGG + Intronic
964786773 3:160404317-160404339 ATCATCCCCTTCCTGTTTTGAGG - Exonic
971691799 4:29846319-29846341 AACACCCCCATGTTGTATTCAGG - Intergenic
973182172 4:47283105-47283127 AACACCCTGAACATGTTTAGAGG + Intronic
974313042 4:60237839-60237861 ATCAAACCCATTATGTTTTGTGG + Intergenic
975137276 4:70887207-70887229 AACTCCCCTTTCCTGTTTTGGGG - Intergenic
976508886 4:85883981-85884003 AAAACTCCCATAATGTTTTGAGG + Intronic
982072437 4:151707211-151707233 AACACAGCCATGATCTTTTGTGG + Intronic
983396188 4:167198950-167198972 AAAACACCCATCATTTTTTATGG + Intronic
983950479 4:173634017-173634039 AACATCTCCATCGTGTTGTGTGG - Intergenic
986024744 5:3840169-3840191 AGCAGGCCCATCATGCTTTGTGG + Intergenic
989519216 5:42381278-42381300 AACATAGCCATCATCTTTTGTGG + Intergenic
989998310 5:50862121-50862143 ATCATCCCCATCATGATCTGAGG - Intergenic
990977420 5:61571903-61571925 AACACTCCCATCTTGTCTAGAGG - Intergenic
991366498 5:65873431-65873453 GAAAATCCCATCATGTTTTGAGG - Intergenic
991616787 5:68505305-68505327 AATAAACCAATCATGTTTTGTGG + Intergenic
992609104 5:78492063-78492085 AACATCCCCATCATACCTTGTGG - Intronic
1008582445 6:52919207-52919229 AACACCCCTAAGATGTATTGTGG - Intergenic
1010672522 6:78703021-78703043 AGCACCCGCATCAGATTTTGTGG - Intergenic
1011211393 6:84959794-84959816 ACCACCCCCATAGTCTTTTGGGG - Intergenic
1014869677 6:126577502-126577524 ATCACTCCCATCATATTTTAAGG - Intergenic
1016035119 6:139376027-139376049 AACAGCCCCATCATGGTGTTGGG - Intergenic
1017546723 6:155459806-155459828 AAAGCCCACATCATCTTTTGTGG - Intergenic
1017952872 6:159151327-159151349 AACACCTCCATTTTCTTTTGGGG + Intergenic
1018527666 6:164731026-164731048 AACATCCCCATCGTGGTTGGTGG - Intergenic
1021176794 7:17458986-17459008 AAAACCCCCACCCTGATTTGAGG - Intergenic
1023406223 7:39835528-39835550 AACTTCCCCATCATGTAATGGGG - Intergenic
1023998214 7:45174886-45174908 ACCACCGCTATCATGTGTTGCGG - Intronic
1028247160 7:88493780-88493802 AACACCACCATCATCTGGTGAGG + Intergenic
1028661327 7:93279659-93279681 AACACCCTGCACATGTTTTGAGG - Intronic
1030229192 7:107187947-107187969 AGCACCTCCATCATGTCCTGTGG + Intronic
1034719346 7:153274885-153274907 ATCATGCCCATCAGGTTTTGGGG + Intergenic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1037877896 8:22557428-22557450 AACATTCCCTTCCTGTTTTGAGG + Intronic
1038851115 8:31277205-31277227 ATCTCCCCCACCAAGTTTTGAGG + Intergenic
1038936928 8:32262383-32262405 CACACCTCCAGCATTTTTTGGGG - Intronic
1039658951 8:39441470-39441492 AAAACCATCATCATGTTGTGTGG + Intergenic
1041020562 8:53633918-53633940 AACAGCTTCATCATGTTATGCGG - Intergenic
1041335374 8:56776232-56776254 ATCACCCTCTTCATGTTTTCAGG - Intergenic
1045415210 8:101959658-101959680 AACATCCCCATCATTCTTTGAGG + Intronic
1045626828 8:104061744-104061766 AACATCCTCATCATTTTTTATGG + Intronic
1046460209 8:114524018-114524040 ACCACCATCATCATGTTTGGCGG - Intergenic
1050641150 9:7668896-7668918 AACTCCCATTTCATGTTTTGTGG - Intergenic
1061442675 9:130617100-130617122 AACACTCCCAGCAAGTTCTGGGG + Intronic
1061934319 9:133848976-133848998 AAAAGACACATCATGTTTTGTGG - Intronic
1186672690 X:11783010-11783032 AGGACCCCCTTCAGGTTTTGTGG - Intergenic
1189707269 X:43771467-43771489 TATAACCCCATCATATTTTGAGG + Intronic
1190731422 X:53228567-53228589 CGCACCCCATTCATGTTTTGTGG + Intergenic
1193121949 X:77832429-77832451 AAAACCCTCATGATGTTTTAAGG + Intronic
1193881598 X:86929657-86929679 AACATACTTATCATGTTTTGTGG - Intergenic
1196635765 X:118000842-118000864 AACAGCCCCAGCAGGGTTTGAGG - Intronic
1200013628 X:153140778-153140800 AACCCACCCATTATGCTTTGAGG - Intergenic
1200025973 X:153259140-153259162 AACCCACCCATTATGCTTTGAGG + Intergenic