ID: 951461723

View in Genome Browser
Species Human (GRCh38)
Location 3:22958241-22958263
Sequence TGTACAGGGACCACTGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951461723_951461731 12 Left 951461723 3:22958241-22958263 CCCATTGCAGTGGTCCCTGTACA No data
Right 951461731 3:22958276-22958298 CCCCTTCCCATCTTTAGCAAGGG No data
951461723_951461729 11 Left 951461723 3:22958241-22958263 CCCATTGCAGTGGTCCCTGTACA No data
Right 951461729 3:22958275-22958297 CCCCCTTCCCATCTTTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951461723 Original CRISPR TGTACAGGGACCACTGCAAT GGG (reversed) Intergenic
No off target data available for this crispr