ID: 951464494

View in Genome Browser
Species Human (GRCh38)
Location 3:22987582-22987604
Sequence ATCTTGTTCTTTAAGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951464492_951464494 -5 Left 951464492 3:22987564-22987586 CCTTCATACACAAAGAATATCTT No data
Right 951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG No data
951464491_951464494 25 Left 951464491 3:22987534-22987556 CCAAGGTTTTAGGCAAATAAATG No data
Right 951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951464494 Original CRISPR ATCTTGTTCTTTAAGACAGA GGG Intergenic
No off target data available for this crispr