ID: 951469211

View in Genome Browser
Species Human (GRCh38)
Location 3:23037287-23037309
Sequence TAAACAAATAGTTTTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951469211_951469213 -10 Left 951469211 3:23037287-23037309 CCTGCTGGAAAACTATTTGTTTA No data
Right 951469213 3:23037300-23037322 TATTTGTTTAAACTAGGAAGTGG No data
951469211_951469216 21 Left 951469211 3:23037287-23037309 CCTGCTGGAAAACTATTTGTTTA No data
Right 951469216 3:23037331-23037353 ATCACATACACAAGGTTGATGGG No data
951469211_951469215 20 Left 951469211 3:23037287-23037309 CCTGCTGGAAAACTATTTGTTTA No data
Right 951469215 3:23037330-23037352 CATCACATACACAAGGTTGATGG No data
951469211_951469214 13 Left 951469211 3:23037287-23037309 CCTGCTGGAAAACTATTTGTTTA No data
Right 951469214 3:23037323-23037345 TAAATGACATCACATACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951469211 Original CRISPR TAAACAAATAGTTTTCCAGC AGG (reversed) Intergenic
No off target data available for this crispr