ID: 951469215

View in Genome Browser
Species Human (GRCh38)
Location 3:23037330-23037352
Sequence CATCACATACACAAGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951469211_951469215 20 Left 951469211 3:23037287-23037309 CCTGCTGGAAAACTATTTGTTTA No data
Right 951469215 3:23037330-23037352 CATCACATACACAAGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951469215 Original CRISPR CATCACATACACAAGGTTGA TGG Intergenic
No off target data available for this crispr