ID: 951472465

View in Genome Browser
Species Human (GRCh38)
Location 3:23070994-23071016
Sequence ATGCTTTTATTGCAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951472465_951472469 -2 Left 951472465 3:23070994-23071016 CCCTGTCTCTGCAATAAAAGCAT No data
Right 951472469 3:23071015-23071037 ATTTAAAAAGTTGCCGGGTGTGG No data
951472465_951472468 -7 Left 951472465 3:23070994-23071016 CCCTGTCTCTGCAATAAAAGCAT No data
Right 951472468 3:23071010-23071032 AAAGCATTTAAAAAGTTGCCGGG No data
951472465_951472471 14 Left 951472465 3:23070994-23071016 CCCTGTCTCTGCAATAAAAGCAT No data
Right 951472471 3:23071031-23071053 GGTGTGGTAGCACACATCTGTGG 0: 4
1: 40
2: 415
3: 1249
4: 3378
951472465_951472467 -8 Left 951472465 3:23070994-23071016 CCCTGTCTCTGCAATAAAAGCAT No data
Right 951472467 3:23071009-23071031 AAAAGCATTTAAAAAGTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951472465 Original CRISPR ATGCTTTTATTGCAGAGACA GGG (reversed) Intergenic
No off target data available for this crispr