ID: 951483754

View in Genome Browser
Species Human (GRCh38)
Location 3:23189305-23189327
Sequence GCAACTAGACTCATTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951483751_951483754 18 Left 951483751 3:23189264-23189286 CCACAAAGTCTTGAGATAAGTTA No data
Right 951483754 3:23189305-23189327 GCAACTAGACTCATTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951483754 Original CRISPR GCAACTAGACTCATTCCAGC AGG Intergenic
No off target data available for this crispr