ID: 951491844

View in Genome Browser
Species Human (GRCh38)
Location 3:23279618-23279640
Sequence GACCCTAAGCTGGTTCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951491844_951491846 -6 Left 951491844 3:23279618-23279640 CCAGTTGGAACCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 951491846 3:23279635-23279657 AGGGTCTATAGCTGCTTATCAGG 0: 1
1: 3
2: 3
3: 2
4: 62
951491844_951491847 15 Left 951491844 3:23279618-23279640 CCAGTTGGAACCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 951491847 3:23279656-23279678 GGAGAGAATATTTGTAAAGCTGG 0: 1
1: 0
2: 2
3: 51
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951491844 Original CRISPR GACCCTAAGCTGGTTCCAAC TGG (reversed) Intronic
913174722 1:116263235-116263257 GGACCTAAGCTGGTTCCAGTTGG - Intergenic
915500265 1:156311119-156311141 GACCCTCAGCTGGTGCCAGGGGG - Exonic
920167397 1:204045524-204045546 GACCCTATGGTGGATCCACCTGG - Intergenic
921986968 1:221322703-221322725 GGCACTAAGCTGGTTGAAACTGG - Intergenic
922544575 1:226446365-226446387 GACCATGAGCTGGTTCTAGCTGG + Intergenic
1077544016 11:3161048-3161070 GACCCCAGGCTGGTCACAACAGG + Intronic
1080724178 11:34878615-34878637 CACCCAAAGAAGGTTCCAACAGG - Intronic
1083094099 11:60232476-60232498 GACTCAGAGCTGGTTCTAACTGG - Intronic
1085279154 11:75319146-75319168 GAACCACAGCTGGCTCCAACAGG + Intronic
1085926997 11:81034827-81034849 GACCCTAAAAGGGTTGCAACCGG + Intergenic
1089701434 11:120246504-120246526 GACCCTTACCTGGCTCCACCTGG - Exonic
1097446847 12:59681900-59681922 GGCTCTAAGCTGGTCCCTACAGG - Intronic
1101510960 12:105391925-105391947 GTCTCTACACTGGTTCCAACTGG - Intronic
1103894500 12:124264180-124264202 GACACTAAGCTTGTTCCACTGGG + Intronic
1104419678 12:128625008-128625030 GACCCTATGCTTGTGCCAATAGG + Intronic
1113064774 13:106361757-106361779 GTCCCTAATCAGGTTCCGACAGG + Intergenic
1114409015 14:22483307-22483329 GACCCTTAGCTGGATCCCTCAGG - Intergenic
1120103090 14:80466572-80466594 GACCCTAAAAGGGTTACAACTGG + Intergenic
1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG + Intronic
1128887444 15:71302023-71302045 AACCCTAAGCTTGCTCCCACAGG - Intronic
1129245436 15:74276307-74276329 CACCCTATGTTGGTTCCAGCAGG - Intronic
1130649258 15:85752715-85752737 GGCCCTGGGCTGGTTCCAACAGG - Intergenic
1142198185 16:88748455-88748477 GACCCCAAGGTGGTTCCCAAGGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1151145737 17:72039216-72039238 AAACCTAAGCTGGGTACAACAGG - Intergenic
1151914156 17:77105169-77105191 GGCCCTAAGCAGTTTCCAGCTGG + Intronic
1156030416 18:32706629-32706651 GTCCCTAAACTGGTTTGAACTGG + Intronic
1160979640 19:1811102-1811124 GCCCCTAAGCTGGTGCCACATGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
933092254 2:78135946-78135968 CACCTTCAGCTGGTTCCATCAGG - Intergenic
939378222 2:141398881-141398903 GACACTAAGCCAGTTCCAGCTGG + Intronic
947396120 2:229688474-229688496 AACCCAAAGATGGTTCCAAGAGG - Intronic
947544166 2:230999524-230999546 GACCCTAAGCTGCATGAAACAGG - Intronic
1169905680 20:10600904-10600926 GATGCTAAGCTGATGCCAACAGG - Intronic
1176085176 20:63292641-63292663 GACCCTGGGCTGCTCCCAACTGG - Intergenic
1185105422 22:48866798-48866820 GACCCTAAGCTGGAGCCAAGTGG + Intergenic
949953005 3:9244809-9244831 GACCCCATGCTGGTGCCAAATGG - Intronic
951491844 3:23279618-23279640 GACCCTAAGCTGGTTCCAACTGG - Intronic
960803279 3:121559747-121559769 GACACTTAGCTGGTGCCCACTGG - Intergenic
967996235 3:195168806-195168828 GACCCTAAGCAGGTTATTACAGG - Intronic
972581653 4:40400343-40400365 GACCCTAAGCAGGACCCAAAGGG + Intergenic
977808192 4:101328010-101328032 GAACCTAAGCTGATTCCAGCAGG + Intronic
980526369 4:133994939-133994961 GACCCTAAAAAGGTTGCAACCGG - Intergenic
984183988 4:176520155-176520177 GACCCTAAGCTCCTTTCATCTGG - Intergenic
984985948 4:185329625-185329647 GGCCCTTTGCTGATTCCAACTGG - Intronic
987310622 5:16678256-16678278 AACCTGAATCTGGTTCCAACTGG + Intronic
989028029 5:37088775-37088797 GACCCTAAAAGGGTTGCAACCGG + Intergenic
993036624 5:82765887-82765909 GACCCTAAACTGCTCCCAATGGG + Intergenic
999162266 5:149511557-149511579 GACAGTAAGCTGGTACCCACTGG - Intronic
1002050877 5:176570238-176570260 GCCCTTAAGCTGGTTCCCTCTGG + Intronic
1005185940 6:23163124-23163146 GACCCTAAAAGGGTTGCAACGGG + Intergenic
1006610850 6:35293500-35293522 GACCCTGAGCTGGATACAACAGG + Intronic
1007653263 6:43436197-43436219 GTCTCCAGGCTGGTTCCAACTGG - Exonic
1010740515 6:79497641-79497663 GACCCTAGACTGGGTCCCACTGG + Intronic
1015248919 6:131106002-131106024 GACATGAAGCTGTTTCCAACAGG + Intergenic
1031156357 7:118116275-118116297 GACCCTAAAAAGGTTGCAACTGG + Intergenic
1036615515 8:10384569-10384591 GACACTGAGCTGGTCTCAACAGG + Intronic
1040337761 8:46424744-46424766 GACCCTAAGCCGCTTCCAGGCGG + Intergenic
1042932909 8:74030964-74030986 GAAAGTAAGCTGGTTCAAACAGG - Intergenic
1047643459 8:126845338-126845360 GACCTCACGCTTGTTCCAACAGG - Intergenic
1051341854 9:16119469-16119491 GACCCTAAGCCAGTTCCAGCTGG + Intergenic
1055720527 9:79168075-79168097 GACCCTAACCTGGTTCTCATTGG - Intergenic
1061566778 9:131446067-131446089 GACCCAAGGCTGGTTTCATCAGG + Intronic
1062419543 9:136473213-136473235 GCCCCAAGTCTGGTTCCAACTGG + Intronic
1190072871 X:47293199-47293221 GGCCCTTTGCTGATTCCAACTGG - Intergenic
1190493100 X:51002430-51002452 GACCCTCAGCTGGATTCCACAGG - Intergenic
1192718000 X:73663985-73664007 GACCCTAAAAGGGTTGCAACTGG - Intronic
1198099212 X:133409648-133409670 GACCATGGACTGGTTCCAACAGG + Intronic
1199772046 X:150981338-150981360 ACCACTAAGCTGGTTCTAACAGG + Intronic