ID: 951496533

View in Genome Browser
Species Human (GRCh38)
Location 3:23334382-23334404
Sequence CTGTGCCCCATCAATAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951496533_951496539 30 Left 951496533 3:23334382-23334404 CCATCACTATTGATGGGGCACAG 0: 1
1: 0
2: 2
3: 6
4: 93
Right 951496539 3:23334435-23334457 TATTGGTGGTACCTACTCATAGG 0: 1
1: 0
2: 3
3: 4
4: 77
951496533_951496536 13 Left 951496533 3:23334382-23334404 CCATCACTATTGATGGGGCACAG 0: 1
1: 0
2: 2
3: 6
4: 93
Right 951496536 3:23334418-23334440 AACGTCCTACAACTGCGTATTGG 0: 1
1: 0
2: 0
3: 0
4: 21
951496533_951496537 16 Left 951496533 3:23334382-23334404 CCATCACTATTGATGGGGCACAG 0: 1
1: 0
2: 2
3: 6
4: 93
Right 951496537 3:23334421-23334443 GTCCTACAACTGCGTATTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951496533 Original CRISPR CTGTGCCCCATCAATAGTGA TGG (reversed) Intronic
902158345 1:14508318-14508340 CTGTTGCACAGCAATAGTGACGG - Intergenic
902265033 1:15257237-15257259 CAGTTCCCCACCAACAGTGAGGG + Intronic
902931015 1:19731581-19731603 CTGTGGCCCATCATCTGTGATGG + Intronic
903563503 1:24246665-24246687 CTGAGCCCCAAGAATAGAGAAGG - Intergenic
905325832 1:37151424-37151446 CAGAGCCCCATCAATTATGATGG - Intergenic
906529390 1:46514812-46514834 CTGACCCCCATCAAGGGTGATGG - Intergenic
906746665 1:48226627-48226649 CTGTGCCCCATGAACAGTGTGGG + Intronic
908656484 1:66394258-66394280 CTCTGCCACATCTATAGTGATGG + Intergenic
910309718 1:85809610-85809632 CTGTGCCCCTTTTATTGTGATGG - Intronic
917678457 1:177341966-177341988 CTGTGCCCTGTCAGGAGTGATGG - Intergenic
921131827 1:212226251-212226273 CTGTTCCACATCACTAATGAAGG - Intergenic
921447767 1:215266528-215266550 CTGTAATCTATCAATAGTGAGGG - Intergenic
921486734 1:215723626-215723648 CTGTGCCTCATTAATGGAGAAGG + Intronic
923045929 1:230355667-230355689 GGCTGCCCCATCAATAGTGGGGG + Intronic
1064939277 10:20714502-20714524 CTGGGCCCCTTCCATAGGGAGGG - Intergenic
1067178583 10:43968268-43968290 CTGGTCCCCATGAACAGTGATGG - Intergenic
1070175520 10:73966230-73966252 CTGTGCCCCAGCAAGGGTGCAGG - Intergenic
1075634096 10:124018693-124018715 TTGAACCCCATCAATAGTGATGG + Intronic
1080945255 11:36965646-36965668 TTGTGCCCCATGAATTGAGAAGG + Intergenic
1082196751 11:49315886-49315908 CTGGGCCACCTCAAGAGTGAAGG - Intergenic
1085456328 11:76667502-76667524 CTGTGCGCCTTCAAGAGAGATGG - Intronic
1085988109 11:81809003-81809025 CTGTGGCCCAGGAATAGTCACGG - Intergenic
1086659078 11:89392313-89392335 CTGGGCCACCTCAAGAGTGAAGG + Intronic
1086993752 11:93333398-93333420 CTGTGCTCCTTCCATAGGGAAGG + Intronic
1087167979 11:95023417-95023439 CTGTAGCCCAGGAATAGTGAAGG + Intergenic
1100935282 12:99657740-99657762 ATGTGCCGCATCAATGTTGATGG - Intronic
1103610795 12:122123082-122123104 CTGTGCCCCGTCAATCTTCAAGG - Intronic
1107122180 13:36807955-36807977 CTGGACCCCATCAATAATAACGG + Intergenic
1108985391 13:56580214-56580236 CTGTGCACCAAGTATAGTGAGGG - Intergenic
1111749428 13:92309259-92309281 CTGTGCCAGATCCCTAGTGAAGG - Intronic
1113697738 13:112358994-112359016 CTGTTCCCCAGGAAGAGTGATGG + Intergenic
1119308974 14:73630908-73630930 CTGAGCCCCAACAATATTTATGG + Intergenic
1120246322 14:82011234-82011256 CTGTCCCTCAGCAGTAGTGATGG - Intergenic
1202918754 14_KI270723v1_random:11757-11779 CTGTGCCCCATAAATATTACTGG + Intergenic
1202925882 14_KI270724v1_random:23297-23319 CTGTGCCCCATAAATATTACTGG - Intergenic
1125455551 15:39855334-39855356 GTGTGTCCCAACTATAGTGAAGG + Intronic
1133264099 16:4572890-4572912 CTGTGACTCATCAGTTGTGACGG - Intronic
1134443497 16:14313413-14313435 CTGAGCCCCAACAATAGGTAGGG + Intergenic
1138226115 16:55296530-55296552 CTGTGCTCCCTCATTAGTGGGGG + Intergenic
1146404687 17:32527114-32527136 CTGTCCCCCTTCACTGGTGATGG - Intronic
1147605408 17:41771420-41771442 CTGTGAACCATCAGTAGGGAGGG - Intronic
1150296235 17:64009090-64009112 CACTGGCCCATCAACAGTGAGGG + Intronic
1154997894 18:21658567-21658589 ATGTGCCCCATTTTTAGTGAAGG - Intronic
1157416781 18:47509974-47509996 CTGAGGCCCATCAGAAGTGAGGG - Intergenic
1158332471 18:56377743-56377765 ATGTGCCCCAACAATATTAAAGG - Intergenic
1158789332 18:60757744-60757766 CTGTGCCTCACCTATAGAGATGG + Intergenic
1161305273 19:3563982-3564004 ATGTGCCCCAACAAGAGTGGGGG + Intronic
1163209750 19:15831600-15831622 CTGTAGCCCAGCAATAGTCAGGG - Intergenic
931628775 2:64281026-64281048 CTGTGCCCCTTCACAAGTGGTGG + Intergenic
941698251 2:168576219-168576241 GTGTGCCCCTTTAATAGTAATGG + Intronic
944913022 2:204328675-204328697 CTGTGCCAAATTAACAGTGAAGG - Intergenic
948437152 2:237961471-237961493 GTGTGCCCCACCCACAGTGAGGG + Intergenic
1168766138 20:382375-382397 CTGTGCCACATCAGTAGTCCAGG - Intronic
1172152798 20:32802278-32802300 CCGTGCCTCATCCATAGTCAGGG + Intronic
1175425012 20:58858088-58858110 CTGTCCCCCATCAATAATTCAGG - Intronic
1181429982 22:22873421-22873443 CTGTGCCCCATTAATAATCAAGG - Intronic
1183526475 22:38326101-38326123 CTGTGCCCTGGGAATAGTGAGGG - Intronic
951496533 3:23334382-23334404 CTGTGCCCCATCAATAGTGATGG - Intronic
953336108 3:42095268-42095290 CTGTGCCTCCTCAAACGTGAAGG - Intronic
956797212 3:72727989-72728011 CAGTGCCCCATCTTTGGTGATGG - Intergenic
960807778 3:121600575-121600597 CTGTGCCCCAACTCTAGCGATGG + Intronic
963111746 3:141694214-141694236 CTGTAGCCCAGGAATAGTGAGGG + Intergenic
963675299 3:148303329-148303351 CTGTGCTCCATAAATATTTATGG - Intergenic
964727577 3:159830697-159830719 CTGTTCCACATCTATAGTGTGGG + Intronic
967124049 3:186408895-186408917 CTGTCCCCCATCGATGGTGCTGG + Intergenic
969648507 4:8448402-8448424 CTGTGTCCCCTCAATAGAAACGG + Intronic
970313439 4:14806603-14806625 CAGTCCCCCATAAATACTGATGG + Intergenic
977976150 4:103269036-103269058 CTGTGCCCCCTCAATAGCACTGG + Intergenic
981538612 4:145825338-145825360 CTTTGTCCCAACAGTAGTGAGGG + Intronic
983436807 4:167725439-167725461 CTATGCACCATCAGTAGGGAAGG - Intergenic
984322284 4:178209886-178209908 GTGTGGCCCATGAATAGTCAGGG - Intergenic
986648561 5:9942017-9942039 CTGGGCTCCATTAATAATGATGG + Intergenic
987367167 5:17159139-17159161 CTGTGCCCCACCTATTGTGATGG + Intronic
991249443 5:64543753-64543775 CTGTGCCCCAACAAAAGTGAAGG + Intronic
992153025 5:73925191-73925213 CTGTGCCTCATAAAGGGTGAGGG - Intronic
992666501 5:79014859-79014881 CTGTGTCTGATCACTAGTGAGGG - Intronic
992884186 5:81141387-81141409 CTGTGCCCCTTCCATAGTGAGGG - Intronic
993165786 5:84353225-84353247 CTGTGCCCAATCAAAAGGGAAGG + Intronic
997683855 5:135775060-135775082 CTGTTCCCAATATATAGTGAAGG + Intergenic
999366219 5:151025386-151025408 CTCCTCCCCATCAATGGTGAGGG - Exonic
1016189088 6:141238284-141238306 ATGTGCCCCAATAATATTGAAGG - Intergenic
1020261903 7:6535573-6535595 CTGTGCCCCACCAAGAGGTAAGG - Intronic
1021087447 7:16439152-16439174 AGGTGCCCCATCTATAGTGGAGG - Intergenic
1023499327 7:40831195-40831217 CTGTGTCCTATCAACAGTGTAGG + Intronic
1026436569 7:70404144-70404166 CTCTGCCCACTCAAAAGTGAGGG - Intronic
1028587440 7:92466126-92466148 CTTCTCCCCATGAATAGTGAAGG + Intergenic
1033995265 7:147337943-147337965 CAGTGCCCCATCAAATGTCAAGG - Intronic
1040551027 8:48437698-48437720 CTGAGACCCATCAGGAGTGAAGG - Intergenic
1043717804 8:83508070-83508092 CTGTAGCCCATGAATAGTCAGGG + Intergenic
1046817112 8:118597067-118597089 CTGTGCCCCATGCATGCTGAGGG - Intronic
1047768153 8:128006233-128006255 CTGTACCCTAGAAATAGTGAGGG + Intergenic
1053319188 9:37080156-37080178 CTGCGCCCCACCACAAGTGAGGG - Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055751746 9:79514040-79514062 CTGTGCCCCATCAAATCTCATGG - Intergenic
1056528913 9:87469814-87469836 CTGTCCCCCACCCATGGTGAAGG + Intergenic
1060643082 9:125255442-125255464 CTGGGCTCCAGCAATACTGATGG - Intergenic
1203442768 Un_GL000219v1:26935-26957 CTGTACCCCATAAATATTAATGG + Intergenic
1203513576 Un_KI270741v1:145844-145866 CTGTACCCCATAAATATTAATGG + Intergenic
1187669716 X:21656710-21656732 CTGTGCCCCAGCAGTGGTGTGGG + Exonic
1194148230 X:90289232-90289254 ATGTGCCCCATCAGTTATGATGG + Intergenic
1195443437 X:104922463-104922485 CTGTGCCACACCAACAGAGATGG - Intronic
1196123277 X:112073161-112073183 CTGTGGCCCATGATTAGTGGGGG - Intronic