ID: 951502538

View in Genome Browser
Species Human (GRCh38)
Location 3:23405597-23405619
Sequence AAGTGAGGGGAGGAGTATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951502532_951502538 15 Left 951502532 3:23405559-23405581 CCTCAAGAATTCTAAAAAGTCAC 0: 1
1: 0
2: 1
3: 16
4: 265
Right 951502538 3:23405597-23405619 AAGTGAGGGGAGGAGTATAGAGG 0: 1
1: 0
2: 4
3: 38
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951502538 Original CRISPR AAGTGAGGGGAGGAGTATAG AGG Intronic
900831549 1:4969211-4969233 AAGGGAGGGGAGGAGAAGGGAGG + Intergenic
901680385 1:10909631-10909653 AGGTGATTGGAGGAGTGTAGTGG - Intergenic
902529683 1:17082779-17082801 GTGTGAGGGGAGGAGGATGGGGG - Intronic
903336552 1:22628230-22628252 AGGGGTGGGGAGGAGTACAGAGG - Intergenic
903443492 1:23405772-23405794 AAGTCAGGAGAGGAGTCTGGAGG + Intronic
903528427 1:24011005-24011027 AGGGGAGGGGAGGAGGAGAGGGG - Intergenic
903996456 1:27307962-27307984 AAGGGAGAGCAGGAGTATTGGGG + Exonic
904354656 1:29931100-29931122 AGGGGAGGGGAGGGGGATAGAGG - Intergenic
905787321 1:40768757-40768779 AAAGGAGGGGAGGAGAAAAGGGG - Intronic
906560371 1:46752258-46752280 AAGGGAAGGGAGGAGGAGAGTGG + Intergenic
906897942 1:49799957-49799979 GAGGGAGGGTAGGAGTAGAGAGG + Intronic
907520711 1:55021722-55021744 AAGAGAGGGGAGGAGAGGAGAGG + Intergenic
907528606 1:55070306-55070328 GAGTGAGGGCAGGAGGATACAGG + Intronic
907621302 1:55983495-55983517 AGGAGAGGGGAGGAGAGTAGAGG + Intergenic
908093096 1:60707053-60707075 AAGGGAAGGGAAGAGTACAGAGG + Intergenic
908510602 1:64847498-64847520 AGGGGAGGGGAGGAGTTCAGAGG + Intronic
908595492 1:65684895-65684917 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
908726331 1:67181347-67181369 AAGTGAGAAGAGAAGTTTAGAGG - Intronic
908748555 1:67398378-67398400 AAGGGAGGGGAGGAGAATAGTGG - Intergenic
908958914 1:69671043-69671065 AAGTGAAGGGAAAAGTAAAGGGG - Intronic
911240675 1:95462477-95462499 TAGTGAAGGGAGGAGAATGGTGG - Intergenic
911668340 1:100580902-100580924 ATGTGTGGGGAGGAGGGTAGAGG + Intergenic
911668496 1:100582518-100582540 AAGGGAGGAGAGGAGCAGAGAGG + Intergenic
912164000 1:107020650-107020672 AAGGGAGGGGAGAAGGAAAGGGG + Intergenic
912902734 1:113670035-113670057 AAGGGAGGGTGGGAGTAGAGTGG - Intronic
915844322 1:159247762-159247784 TAGTGAGGGGAGAAGCAAAGAGG + Intergenic
917537132 1:175882461-175882483 AAGGGAGGGGAGGAGGTGAGAGG + Intergenic
918102144 1:181385747-181385769 AAGAGAGGAGAGGAGGAAAGAGG - Intergenic
918627266 1:186670501-186670523 AAGTGAAGGAAAGAGTATGGTGG + Intergenic
918687912 1:187442688-187442710 AAGTGAAGAGAGGAGGAAAGAGG - Intergenic
918722304 1:187868679-187868701 AAGGGAGGGGAGGAGAGGAGAGG - Intergenic
919932799 1:202232363-202232385 GTGTGAGGGGAGGAGTGTTGAGG + Intronic
921044644 1:211466550-211466572 AAGAGAGGGGAGGAGGAGATGGG + Intergenic
921555714 1:216596472-216596494 AAGCTAGCGGAGGAGTATAATGG - Intronic
922000194 1:221469591-221469613 AAGAGAGAGGAGGACTGTAGAGG + Intergenic
922162375 1:223088200-223088222 GAGTGAGGGGAGGAGGAGAAGGG - Intergenic
922209806 1:223478631-223478653 AAGTGCGGGGAGGAGGACAAGGG + Intergenic
922321708 1:224494459-224494481 CAGGGAGGGGAGGATGATAGAGG + Intronic
922795031 1:228335620-228335642 CAGTGATGGGAGGAGAACAGGGG - Intronic
924267233 1:242295278-242295300 AAGGGAGGAGAGGAGAAGAGGGG - Intronic
924491636 1:244543830-244543852 AGGTGAGGGGAGAAACATAGTGG + Intronic
1063180867 10:3598634-3598656 AGGTGAGGGGAGGAGCAGAAGGG + Intergenic
1064064465 10:12169208-12169230 AAGTGAGGGGAGGTGGAGAGAGG - Intronic
1064222831 10:13456113-13456135 AGGATAGGGGAGGAGTAGAGAGG - Intronic
1064518049 10:16171269-16171291 ATGAGAGGCGAGGAGTTTAGTGG - Intergenic
1064529835 10:16297054-16297076 AGGGGAGGGGAGGAGAAGAGAGG + Intergenic
1066487042 10:35856156-35856178 AAGGGAGGGAAGGAGGAGAGAGG - Intergenic
1066603789 10:37138654-37138676 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
1066717589 10:38303228-38303250 AAGGGAGGAGAGGAGAAGAGGGG + Intergenic
1067922379 10:50472915-50472937 CAGTGTGGGGAGCAGGATAGAGG - Intronic
1068375139 10:56168224-56168246 AAATCAGTGGAGGAGAATAGAGG - Intergenic
1069626433 10:69870727-69870749 AGGTGAGGGGTGGAGAACAGAGG + Intronic
1069825528 10:71253086-71253108 AAATGAGGGGAGGATTTTAGAGG - Intronic
1070505531 10:77109738-77109760 AAGTTAGGGGAGGAACATAAAGG + Intronic
1071665202 10:87548310-87548332 AGGGGAGGGGAGAAGAATAGTGG - Intronic
1071988584 10:91076922-91076944 GACAGAGGGGAGGAGTAAAGGGG - Intergenic
1072382489 10:94889919-94889941 AAGGGAGGGTGGGGGTATAGGGG - Intergenic
1072410265 10:95195676-95195698 TGGGGAGGGGAGGAGAATAGAGG - Intronic
1072450490 10:95535765-95535787 GGGTGAGGGAGGGAGTATAGGGG + Intronic
1072454965 10:95567611-95567633 ATGGGAGGGGAGGAGAAAAGAGG + Intergenic
1072812214 10:98470785-98470807 AAGTGAGTGGAGGTGAAGAGGGG + Intronic
1073823400 10:107291451-107291473 AAGTGAAGGGAAAAGTAAAGGGG - Intergenic
1073911217 10:108347043-108347065 AAGTGAGGGGAGAGGGAAAGAGG + Intergenic
1074326301 10:112455173-112455195 AGGTGAGGGGAGGAGGGGAGGGG - Intronic
1075001560 10:118802491-118802513 AAGAGTGGGGAGGAGGACAGAGG + Intergenic
1075489794 10:122856861-122856883 AAGTGGAGGGAGGGATATAGTGG - Intronic
1075627221 10:123972254-123972276 AAGGGAGGGGAGGAGTAGGGAGG + Intergenic
1075688542 10:124380133-124380155 GAGTCAGGGGAGGAGCATGGAGG - Intergenic
1075688607 10:124380420-124380442 GAGTCAGGGGAGGAGCATGGAGG - Intergenic
1076084291 10:127611506-127611528 AAGAGTGGGAAGGAGTATAGAGG - Intergenic
1076509337 10:131000952-131000974 CAGTGAGTGGAGGAGCAGAGAGG + Intergenic
1076738398 10:132468661-132468683 AGGGGAGGGGAGGGGTCTAGCGG + Intergenic
1077007998 11:368257-368279 AAGTTAGGGGAGGAGGATGGAGG + Intergenic
1077108125 11:850616-850638 AAGTGAGGAGAGGAGAGGAGAGG - Intronic
1077391387 11:2302115-2302137 AAGGGAGGGGAGGAGAGGAGAGG + Exonic
1077662555 11:4082670-4082692 AAGCGAGGGGAGAAGCAAAGGGG - Intronic
1078246389 11:9575485-9575507 AAGTGAGGGGAGGAGTCCAGCGG + Intronic
1078733683 11:14000246-14000268 AAGTGAGGGAGGGAGTTTTGTGG - Intronic
1079786844 11:24684052-24684074 AATTGAGGGGAGGAGAACAAAGG - Intronic
1081742363 11:45449584-45449606 AGGTGAAGGGAGCAGTAAAGAGG - Intergenic
1083939651 11:65888731-65888753 AAGTGAGGGGAGAAGTTACGGGG - Intergenic
1084191786 11:67502693-67502715 AAGAGCCGGGAGGAGTCTAGTGG - Exonic
1084468712 11:69342724-69342746 AAGGGAGGGGAGGTGTTTGGGGG + Intronic
1084500284 11:69531087-69531109 AAGGGAGGGGAGGAGAGAAGAGG + Intergenic
1085363891 11:75919401-75919423 AAGTTAGGGGAGGAATTAAGAGG + Intronic
1085855528 11:80171720-80171742 AAGTAAGGGGAAGAGTAAGGAGG - Intergenic
1085917926 11:80913532-80913554 AGATGAGGGGAGGAGAACAGAGG + Intergenic
1085923695 11:80989687-80989709 AGGTGAGGGAAGGAGGACAGGGG - Intergenic
1087454044 11:98361083-98361105 AAGGGAAAGGAGGAGTGTAGAGG + Intergenic
1088920545 11:114257424-114257446 AAGAGAGGGGAGGAGTGGAAAGG - Intergenic
1089125639 11:116174659-116174681 AGGGGAGGGGAGGAGGATGGTGG - Intergenic
1089170111 11:116505950-116505972 AAGTGAGAGGAGGAGAGAAGGGG - Intergenic
1089331030 11:117689040-117689062 AGATGAGGGGAGGAGGATGGTGG - Intronic
1089937077 11:122375580-122375602 AAGTGGAGGGAAGAGTAAAGAGG + Intergenic
1090094167 11:123727296-123727318 AAATGATGGGAGGAGAAAAGAGG + Intronic
1090446109 11:126766184-126766206 AAGAGAGGGGAGGAGGAGAGAGG - Intronic
1090516955 11:127438861-127438883 AAGAGAGGGGAGGAATGGAGGGG - Intergenic
1090659831 11:128873966-128873988 GAGTGTGGAGAGGAATATAGAGG + Intergenic
1091873396 12:3913774-3913796 AAGGGAGGGGAGAAGAGTAGGGG - Intergenic
1092791137 12:12071898-12071920 AAGTGAGGGGGAGAGGAGAGGGG + Intronic
1095089764 12:38092744-38092766 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1095148737 12:38764258-38764280 AAGTTAGGGGAGGGCTGTAGGGG + Intronic
1095798565 12:46247462-46247484 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
1095827370 12:46544655-46544677 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1096480251 12:51935486-51935508 AAGAGAGAGGAGGACTATGGAGG - Intergenic
1096812238 12:54178505-54178527 AAGAGAGGGGATGAGTCTATAGG - Intronic
1098514246 12:71355270-71355292 AAGAGAGGGAAGGAGAATAGGGG + Intronic
1099092665 12:78333194-78333216 AAGAAAGGGGAGGAGTAGAAAGG - Intergenic
1099591294 12:84593986-84594008 AAGTGAGGGGACAAATATTGTGG - Intergenic
1100398008 12:94201614-94201636 TAGTGAAGGAAGGAGGATAGTGG - Intronic
1103237963 12:119389737-119389759 AAGTGATGGGAGGTGGGTAGGGG - Intronic
1103365810 12:120382372-120382394 AAGGGAGGGAGGGAGTACAGTGG + Intergenic
1103527854 12:121579527-121579549 AGGTGGGGGGAGGAGAATCGGGG + Intronic
1103967345 12:124648122-124648144 AAATGAAGGGATGATTATAGGGG - Intergenic
1104078585 12:125411177-125411199 GAGTGAGTGGAGGAGTGGAGTGG + Intronic
1104178795 12:126357902-126357924 AAGAGAGGGGAGGGGAAGAGAGG + Intergenic
1105201500 13:18183605-18183627 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1105464954 13:20631213-20631235 AAGTGGACTGAGGAGTATAGAGG + Intronic
1105891338 13:24684624-24684646 AACTGAGGGGAGGATGTTAGTGG + Intronic
1105999424 13:25706211-25706233 AAGAAAGGGGAGCAGTTTAGAGG + Intronic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1108551759 13:51553135-51553157 AAATGGGGGGAGGAATAAAGGGG - Intergenic
1109575384 13:64249922-64249944 AAGTGAGGTAGGGAGGATAGTGG - Intergenic
1109727419 13:66361221-66361243 AAGTGAGTGGAGGAGTAAAGGGG - Intronic
1110076458 13:71250543-71250565 AAGTGAAGGGAGGAGAAAAAGGG + Intergenic
1110687208 13:78389020-78389042 AACTGAAGGGAGAAGTTTAGGGG + Intergenic
1110759278 13:79212814-79212836 AATTCAGTGGAGGAGTATATTGG - Intergenic
1112108073 13:96264037-96264059 AGGAGTGGGAAGGAGTATAGAGG - Intronic
1112835511 13:103509324-103509346 AAGTGAGAGGAGGAGTTTGCAGG + Intergenic
1112962624 13:105145453-105145475 AGGTGAGGGGAGGAGAGTAAAGG + Intergenic
1113212933 13:108003370-108003392 AAGTGAAGGGAAAAGTAAAGTGG - Intergenic
1114655836 14:24315154-24315176 CAGGGAGGGGAGGAGTTTAGTGG - Intronic
1115055610 14:29122254-29122276 AAGTGGGGAAAGGAGTATAAGGG + Intergenic
1116496267 14:45564439-45564461 CAGGGAGGGTAGGAGTTTAGAGG - Intergenic
1117407227 14:55416078-55416100 AAGTGAGGAGAGGGGAATGGGGG + Intronic
1118584439 14:67339490-67339512 AGGTGAGGGCAGGAGTATTTAGG - Intronic
1118995953 14:70836136-70836158 AAGTGAGGGGAGTATTATAGAGG + Intergenic
1119027239 14:71163935-71163957 AAGTGTGGGTAGGATCATAGTGG - Intergenic
1119752517 14:77089857-77089879 TAGTTGGGGAAGGAGTATAGGGG + Intergenic
1119997094 14:79265202-79265224 AAGTGAGGGTAGGAGGAATGGGG + Intronic
1120625989 14:86827079-86827101 AAGGGAGGGGAGGGGAGTAGAGG + Intergenic
1120965980 14:90168084-90168106 AAGTGAGGGGCGGGGTGTGGTGG + Intronic
1121391404 14:93578538-93578560 AATTGTGGGGAGGAGTATTTGGG - Intronic
1121798630 14:96755471-96755493 AAGGGAGGAGAGGGGCATAGGGG + Intergenic
1122260808 14:100521385-100521407 AAGGGAGGGGAGCAGAATGGGGG - Intronic
1122439287 14:101718976-101718998 AAGGGAGGGGAGGAGAAGGGAGG + Intergenic
1122635858 14:103129371-103129393 AGGTGAGGGAAGGAGCAGAGAGG + Intronic
1126424442 15:48511610-48511632 AAGTGAGGGGCCGAGTAGAAGGG - Intronic
1127900278 15:63335983-63336005 AAGGGAGGGGAGGAGAATTCTGG + Intronic
1127971064 15:63962056-63962078 AAGTGAGAAGAGAAGTTTAGAGG - Intronic
1129445226 15:75612357-75612379 ACGTAAGGCGAGGAGTAGAGTGG - Intronic
1130044658 15:80434677-80434699 AAGTGAGTGGAGGAAGAGAGGGG + Intronic
1130155000 15:81342825-81342847 AAGGGTGGGGAGCAGTCTAGGGG + Intronic
1130262264 15:82365034-82365056 AAGTGAGGGGAGGATTGCAAGGG - Intergenic
1130278966 15:82503973-82503995 AAGTGAGGGGAGGATTGCAAGGG + Intergenic
1130623175 15:85485284-85485306 AAGTGAGGGGAGGATTGCAAGGG - Intronic
1131075747 15:89493966-89493988 AACAGAGGAGAGGGGTATAGGGG - Intronic
1133368268 16:5228380-5228402 AAGAGAGAGGAGGAGAAGAGAGG + Intergenic
1133725117 16:8530282-8530304 AATTGAGGGGGTGAGTATTGCGG + Intergenic
1133813230 16:9177361-9177383 AGGAGAGGGGAGGAGAAGAGGGG - Intergenic
1134129758 16:11641224-11641246 AAGAGAGGGGAGGGGAAGAGGGG + Intergenic
1134566522 16:15256700-15256722 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134735974 16:16499999-16500021 AAGTGAGGGAAGGAGGATGATGG + Intergenic
1134771358 16:16812249-16812271 GAGGGAGAGGAGGAGGATAGAGG + Intergenic
1134931550 16:18212160-18212182 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1136048582 16:27634695-27634717 AAGTGAGGTGAGGAGAGGAGGGG - Intronic
1138191557 16:55017743-55017765 GAATGAGGGGAGGAGTACGGGGG + Intergenic
1138242200 16:55436201-55436223 AAGGGAGGGGAGGAGAAGAGAGG + Intronic
1139631421 16:68234164-68234186 AAGTGAGGGTAGGAGGAAGGAGG + Intronic
1141173151 16:81703849-81703871 AGGGGAGAGGAGGAGGATAGGGG + Intronic
1141359444 16:83381929-83381951 AAGTGAGGGAAGGAGTGCACAGG - Intronic
1141493911 16:84393689-84393711 CAAAGAGGGGAGGAGGATAGAGG + Intronic
1141659907 16:85436199-85436221 AGGAGAGGAGAGGAGTTTAGGGG - Intergenic
1141713938 16:85716362-85716384 AAGGGAGGGAAGGAGGAGAGAGG + Intronic
1141884485 16:86882428-86882450 AAGAAAGGGCAGGAGAATAGAGG + Intergenic
1143091460 17:4451468-4451490 AAGTGAGGGTGGGAGAAGAGAGG + Intronic
1143114233 17:4572707-4572729 AGGTGAGGGGTGGAGCAAAGGGG - Intergenic
1143720760 17:8807480-8807502 AGGTGAGGGGAGGAGGGTGGAGG + Intronic
1143873063 17:9971523-9971545 AAGTGTGGGCTGGAGTGTAGTGG - Intronic
1144392685 17:14810597-14810619 AAGTGACTGAAGGAATATAGGGG - Intergenic
1145935147 17:28710982-28711004 AAGGGAGGGAAGGAGTAGGGCGG + Intronic
1146001301 17:29132102-29132124 AAGTTAGGGGCGGGGTATGGAGG + Intronic
1147455378 17:40534703-40534725 AAGGGAGGGGTGGAGTGCAGAGG + Intergenic
1147704233 17:42414952-42414974 AGGGGAGGGGAGGGGTGTAGGGG - Intronic
1148853811 17:50567694-50567716 AAGGGTGGGGAAGAGTAAAGAGG - Intronic
1149229189 17:54513304-54513326 GAGTGAGGGGAGGAACTTAGAGG - Intergenic
1150132162 17:62675100-62675122 AGGTGAAGGGAGGAGTAGAGAGG + Intronic
1152410583 17:80120631-80120653 AGGTGAGGGGAGGAGGGGAGGGG - Intergenic
1153402495 18:4696093-4696115 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1155069735 18:22304126-22304148 AAGTGAGGAGACCAGTAAAGAGG - Intergenic
1156670619 18:39465114-39465136 CTGTAATGGGAGGAGTATAGAGG - Intergenic
1157014101 18:43688788-43688810 GAGTGAGATGAGGAGGATAGAGG - Intergenic
1157877432 18:51286923-51286945 ATGTGAGGGGAGGAACCTAGTGG + Intergenic
1157952888 18:52060108-52060130 AACTGAGGGCTGGAGTATAGAGG - Intergenic
1158053340 18:53250549-53250571 AAGAAAGGGGAGGAGACTAGGGG - Intronic
1158528588 18:58237210-58237232 AAGTGGGGGGCGGGGAATAGAGG - Intronic
1159042945 18:63342655-63342677 AAGAGATGGGAGGAGTACACAGG + Intronic
1159529458 18:69637036-69637058 GAGTGAGGAGAGGGGTATGGCGG - Intronic
1161028561 19:2047729-2047751 AAGGGAGGGGAGCAGCTTAGGGG - Intronic
1161252022 19:3285630-3285652 GCGTGAGGGGAGGGGTATAGGGG - Intronic
1162404878 19:10467644-10467666 GAGTGAGGGGAGGAGTGGAGGGG - Exonic
1163313244 19:16526305-16526327 AGGGGAGGGGAGGAGCACAGAGG + Intronic
1163669690 19:18620378-18620400 AAGAGAGGGGAGGAGGGAAGTGG - Intronic
1163978074 19:20871576-20871598 ATGTGAGGGTTGGAGTAAAGAGG - Intergenic
1164357956 19:27464256-27464278 AAGTGAGAGGAGAAGTTTAGAGG + Intergenic
1164853610 19:31503870-31503892 GAGGGAGGGGAGGAGGAAAGGGG + Intergenic
1164864581 19:31593210-31593232 GAGTGAGGAGAGGAGGAGAGAGG + Intergenic
1166240407 19:41487785-41487807 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1166578923 19:43874752-43874774 AATTGAGAGAAGGAGTATAAAGG - Intronic
1166759953 19:45218136-45218158 AAAAGAGGGGAGGAGGAAAGGGG - Intronic
1167006058 19:46777358-46777380 AAGTGCGTGGAGGAGAATAATGG - Exonic
1167112566 19:47470910-47470932 AAGTGGGGAGAGGAGTTTAGAGG + Intronic
1167315142 19:48758398-48758420 ACGTGAGGGGAGGTGTAGAGGGG - Intergenic
1167471779 19:49679675-49679697 AAGTGAGGGGAGAAGAAAGGGGG - Intronic
1168099527 19:54133880-54133902 GAGTGAGGGGAGGTGGAGAGAGG - Intergenic
925816827 2:7761416-7761438 AAAAGAGGGGAAGAGGATAGTGG - Intergenic
925942436 2:8834065-8834087 AAGTGGGAGGAGGAGAAGAGGGG - Intronic
926645978 2:15290027-15290049 AAGAGAGGAGAGGAGAAGAGGGG + Intronic
927425340 2:22975242-22975264 ATTAGAGGGGAGGAGTATATTGG - Intergenic
927438453 2:23090589-23090611 AGGGGAGGGGAGGAGGAGAGGGG + Intergenic
928084473 2:28337236-28337258 AAGTGAGGGGAGGAGAAGGGAGG - Intronic
928310970 2:30209553-30209575 AAGAGAGGAGAGGAGAAGAGAGG - Intergenic
928612922 2:33008764-33008786 AAGGCAGGGTAGGAGGATAGAGG + Intronic
928883131 2:36119872-36119894 TAGTGGGGGGAGGAGAATGGTGG - Intergenic
929028663 2:37629892-37629914 TAGTGATGGGAGGGGTACAGGGG - Intergenic
929434095 2:41914122-41914144 AGGTGAGTGGAGGAGGATGGGGG - Intergenic
929618000 2:43327458-43327480 GAGTGGGGGGAGAAGTAAAGAGG + Intronic
929694639 2:44103915-44103937 AAGCGTGGGGAGGAGGATTGCGG - Intergenic
929815469 2:45227764-45227786 AAGAGAGGGGAGAAGAACAGGGG + Intergenic
930571726 2:53094534-53094556 AAGGGAGGGGAGGAGAAGAGAGG + Intergenic
931447228 2:62336731-62336753 AAGTGAGGGAAGGAACATTGTGG - Intergenic
933294757 2:80476687-80476709 AAGAGAGGGGAGGAGCATTGTGG - Intronic
933775851 2:85770785-85770807 AAGAGAGAGGAGGAGGAAAGGGG - Intronic
933997525 2:87680525-87680547 AAGGGAGGGGAGGAGAAGGGAGG + Intergenic
934603680 2:95678455-95678477 AAGTGAAGGGAGGAGCATTAAGG - Intergenic
934605031 2:95688208-95688230 AAGGGAGTGAGGGAGTATAGTGG - Intergenic
935660916 2:105466235-105466257 AAGTGAGGGAAGGAGCAGAGAGG + Intergenic
936296327 2:111270387-111270409 AAGGGAGGGGAGGAGAAGGGAGG - Intergenic
936537060 2:113320693-113320715 AAGTGAAGGGAGGAGCATTAAGG - Intergenic
936564359 2:113571646-113571668 AAGGGAGAGGAGGAGTGTACAGG + Intergenic
936635090 2:114246943-114246965 GAGGGAGGAGAGGAGAATAGAGG - Intergenic
939741596 2:145915018-145915040 AAGGAAGGGGAGGAGGATGGGGG - Intergenic
942286978 2:174429176-174429198 AGGAGAGAAGAGGAGTATAGGGG - Exonic
942375626 2:175333875-175333897 AAGAGAGGAGAGGAGAAGAGGGG + Intergenic
942793405 2:179787808-179787830 AAGTAAGGAGAGAAGTATATTGG - Intronic
942834608 2:180278394-180278416 AAGTGATGTGAGGAGTAAAAGGG - Intergenic
943058191 2:183009368-183009390 AAGGGAGGGGAGGAGGAAAGAGG + Intronic
943218057 2:185064932-185064954 AAGTGAGGTAAGGAATACAGAGG - Intergenic
944017145 2:195054855-195054877 AAGGAAGGGGAGGAGAATATTGG + Intergenic
944256190 2:197625708-197625730 AAGGGAGGGGAGGAGAGGAGAGG - Intronic
944405222 2:199376479-199376501 AACTGGGGGAAGGGGTATAGTGG + Intronic
947056375 2:226108664-226108686 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
947098770 2:226595992-226596014 GAGTGAGGGGAGGAGATTTGCGG - Intergenic
948090676 2:235292132-235292154 AGGGGAGGGGAGGAGTGGAGGGG + Intergenic
948653830 2:239464771-239464793 AAGTGAGGGGAGGAGCCTGGCGG + Intergenic
948920488 2:241063915-241063937 AAGGGAAAGGAGGAGTCTAGGGG - Intronic
949047809 2:241880179-241880201 AAGGGAGGGGAGGGGAAGAGAGG + Intergenic
1169254973 20:4090313-4090335 AAGGGAGGGGTGGAGAATTGCGG + Intergenic
1170775802 20:19373715-19373737 AGGTGAGGGGAGAAATTTAGTGG + Intronic
1170998135 20:21385688-21385710 AAGTGAAGGGAGGAGAGTGGGGG + Intronic
1171069095 20:22048998-22049020 AGGGGAGGGGAGGAGAAGAGAGG - Intergenic
1171389192 20:24790250-24790272 GAGTGAGGGGAGGAGTGAGGGGG + Intergenic
1172377726 20:34459028-34459050 AAGTGAGGGCAGCAGTTTTGTGG - Intronic
1173849271 20:46207546-46207568 AAGGGAGTGGAGGAGTTCAGAGG + Intronic
1174278334 20:49419906-49419928 GAGCAAGGGGAGGAGTAAAGGGG - Intronic
1175107533 20:56625904-56625926 AAGTGAGGCGAGGAGCTGAGGGG - Intergenic
1175426804 20:58872669-58872691 AGGTGAGGGGAAGAGAAAAGGGG + Intronic
1175487439 20:59355875-59355897 AAGAGAGGGGAGAAGGAGAGAGG - Intergenic
1175614292 20:60380065-60380087 AAGAGGGAGGAGGAGTATATGGG + Intergenic
1176125417 20:63472726-63472748 AGGAGAGGGGAGGAGAAGAGAGG + Intergenic
1176221475 20:63971056-63971078 AAGGGAGGGGAGGAGAAGGGAGG - Intronic
1176942734 21:14943579-14943601 AAGTGGTGAGAGGAGTGTAGAGG + Intergenic
1177264392 21:18764668-18764690 AAGTGCTGGGAGGAGAAGAGTGG + Intergenic
1178170561 21:30035226-30035248 AGGGGAGGGGAGGAGAAGAGAGG - Intergenic
1178751269 21:35305730-35305752 AAGAAAGGGGAGGAGAAGAGAGG - Intronic
1179084851 21:38207583-38207605 AAGGGAGGAGAGGAGAAAAGAGG - Intronic
1179452085 21:41474241-41474263 AAGTGAGGGGATGAGCAAGGAGG + Intronic
1179621817 21:42621351-42621373 AAGGGAGGGGCGGAGTCCAGCGG + Intergenic
1179913000 21:44460133-44460155 AAGGGAGGGGAGGACATTAGAGG - Exonic
1181907622 22:26211941-26211963 AAATGAGGAGAGGAATATGGGGG + Intronic
1183631697 22:39037067-39037089 AAGTGAGGGCAGGAGTGCTGGGG + Intergenic
1183771404 22:39929206-39929228 AAGTGGGGTGAAGAGTACAGGGG + Intronic
1184309839 22:43634021-43634043 AAGTGAGGGGAGGAGAACACAGG + Intronic
1185027249 22:48421979-48422001 GAGTGATGGAAGGAGTAAAGTGG + Intergenic
950036646 3:9890817-9890839 AAGTGAGGCGAGGAGCACGGAGG + Intronic
950374402 3:12558451-12558473 GAGCGAGGGGAGGAATACAGAGG - Intronic
950459498 3:13112743-13112765 AGGTCAGGGGAGGGGCATAGGGG - Intergenic
950816995 3:15715575-15715597 AAGGAAGGGGAGGAGGAGAGAGG + Intronic
951502538 3:23405597-23405619 AAGTGAGGGGAGGAGTATAGAGG + Intronic
951842204 3:27046615-27046637 AAGTAGGGGGAGGAGAAAAGGGG - Intergenic
952945297 3:38474939-38474961 CAGTGAGGGGAGGAAGGTAGGGG + Intronic
953215887 3:40917601-40917623 AAGTGAAGGGAAGGGGATAGGGG + Intergenic
953434582 3:42868368-42868390 AAGGGAGTGGAGGAGTATGAGGG - Intronic
953854842 3:46493415-46493437 AAATGAGGGGAGGAATATTCAGG - Intergenic
956097724 3:65734880-65734902 AGGTGAGGGGAGGAGAAGGGAGG + Intronic
956878741 3:73489484-73489506 AAGTGAGAGGAGGACTTCAGAGG + Intronic
957326924 3:78707754-78707776 AAGCCTGGAGAGGAGTATAGTGG + Intronic
958027717 3:88068363-88068385 AAGTGAAGGGAGAAGAAAAGTGG + Intronic
959267329 3:104158894-104158916 AAGAGAGGGAAGCAGAATAGGGG + Intergenic
959365424 3:105452201-105452223 GAGTGAGGGGAGGAACTTAGAGG - Intronic
959590302 3:108073003-108073025 AAATGAGAGGGGGAGTTTAGTGG - Intronic
959896837 3:111615735-111615757 TAGTGAGGGGAGGAGGGAAGTGG + Intronic
960594969 3:119400023-119400045 AAGTCATGGGATAAGTATAGGGG - Intronic
961364370 3:126389986-126390008 AAGAGATGGGAGGAGGACAGGGG + Intergenic
962436278 3:135370114-135370136 CAGGGAAGGGAGAAGTATAGAGG - Intergenic
963219567 3:142793186-142793208 AAGTGGGGGGAGGAGGCTAATGG - Intronic
964607142 3:158571676-158571698 AGGTGGGGGGAGGAGAATTGAGG + Intronic
964672507 3:159242141-159242163 AAGTGTGGGTTGTAGTATAGAGG + Intronic
964820440 3:160763106-160763128 AAGCAAGGGGAGGAGGATAGAGG - Intronic
965160672 3:165129335-165129357 AAGTGAAGGGAATAGTAAAGGGG - Intergenic
965681093 3:171252396-171252418 AAATGAGGGGAGGAGAAGAGAGG + Intronic
967274060 3:187756625-187756647 AAGAGAGGAGAGGAGAAGAGAGG + Intergenic
968181727 3:196600082-196600104 AAGCGAGGAGAGGAGCAGAGAGG - Intergenic
968462476 4:732326-732348 AAGGGAGGGGAGGAGGGAAGGGG - Intronic
969108848 4:4828799-4828821 AGGGAAGGGGAGGAGGATAGAGG - Intergenic
969131097 4:4991619-4991641 GAGTGAGCGGAGGCGTTTAGGGG + Intergenic
969323058 4:6424673-6424695 AAGTGAGGGGAAGGGCATGGAGG + Intronic
970542751 4:17095996-17096018 AGGGGAGGGGAGGAGAAGAGAGG - Intergenic
971553777 4:27986060-27986082 TATTGAGGGGAGGAGAATAAGGG + Intergenic
972416828 4:38848706-38848728 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
972727051 4:41753999-41754021 AGGGGAGGGGAGGAGTGGAGTGG - Intergenic
973942154 4:55922105-55922127 AAGTGAGGGGCCGAGCATGGTGG + Intergenic
974643445 4:64664024-64664046 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
975073755 4:70178390-70178412 AAGGGAGGAGAGGAGAATGGAGG - Intergenic
975095694 4:70454031-70454053 AGGAGAGGGGAAGAGTAAAGAGG - Intronic
976401775 4:84615237-84615259 AAGACAGGAGAGAAGTATAGGGG - Intronic
976590420 4:86844401-86844423 AAGGGAGGGGTGAAGAATAGGGG - Intronic
977376626 4:96213131-96213153 AAGAGAAGGGAGGAGAAGAGAGG - Intergenic
977588717 4:98803486-98803508 AGGTCAGGGGATGAGTGTAGAGG - Intergenic
978220118 4:106261785-106261807 AATTAAGAGGAGGAGTATACTGG + Intronic
978327339 4:107574730-107574752 AAGTGCTGGGAGGAGAAGAGTGG + Intergenic
978880373 4:113695354-113695376 AATTCAGGGGAGGAGTAGAGAGG - Intronic
980330837 4:131408992-131409014 AAGTGCTGGGAGGAGAAGAGTGG - Intergenic
981709160 4:147691878-147691900 ATGTCAGGGGAGGAGCCTAGTGG - Intergenic
982443338 4:155461690-155461712 AAGTGGGGGGAAGAGTAGTGTGG + Intergenic
983721036 4:170851733-170851755 AAGTGGAGGGAGGAGGAAAGTGG + Intergenic
983744550 4:171181376-171181398 AAGTGTGGTGAGGAGCATGGTGG - Intergenic
984002449 4:174266624-174266646 AAGTCATGGAGGGAGTATAGTGG + Intronic
984730519 4:183064184-183064206 AATTGAGAGGAGGAGTACAGGGG - Intergenic
985211866 4:187604078-187604100 AGGGGAGGGGAGGAGGAGAGGGG - Intergenic
986126963 5:4892279-4892301 AAGTGAGGAGACAAGTTTAGAGG - Intergenic
986430908 5:7680059-7680081 AATGAAGGGGAAGAGTATAGGGG + Intronic
988818042 5:34853540-34853562 AAGAGAGGGGAAGAGAATAGAGG + Intronic
989226338 5:39033680-39033702 TAGTCAGGGGAGGAGGAAAGAGG + Intronic
990440448 5:55839569-55839591 ACTCCAGGGGAGGAGTATAGGGG - Intergenic
990524411 5:56610578-56610600 AAGGAAGGGGAGGAGTGCAGAGG - Intergenic
991422487 5:66455379-66455401 AAGTGAGGTGGGGAGGAAAGTGG - Intergenic
991540341 5:67720582-67720604 AAGTGAGGGGAGGGGAGGAGAGG - Intergenic
991772705 5:70054338-70054360 AAGTGTGTGGAGGAGAAAAGAGG + Intronic
991851998 5:70929762-70929784 AAGTGTGTGGAGGAGAAAAGAGG + Intronic
992225679 5:74618107-74618129 AGGTGAGGGGAAGACTTTAGAGG - Intergenic
992937197 5:81719898-81719920 AAGTTAGGGTAGGGGGATAGTGG + Intronic
994263370 5:97685920-97685942 CAGTGGGGGGTGGAGTACAGGGG - Intergenic
995291281 5:110458196-110458218 AAGTGAGGGGTAGAGAAGAGAGG - Intronic
996500604 5:124211914-124211936 GTGTGAGGGGAGGGGTATATGGG - Intergenic
998490144 5:142539549-142539571 AAGGGAGGGGAGGAGGGAAGGGG - Intergenic
998638978 5:143987716-143987738 AAGTTAGGGGAAGAGGAGAGAGG - Intergenic
999702571 5:154241324-154241346 CAGAGAGGGGTGGGGTATAGAGG + Intronic
999832478 5:155333651-155333673 AAGGGATGGGAGGAGGAGAGGGG + Intergenic
1000067341 5:157706053-157706075 AGGTGGGGTGAGGAGTAAAGAGG - Intergenic
1000904541 5:166948518-166948540 AAGGGAGGGAAGAAGTATAATGG + Intergenic
1001206452 5:169768085-169768107 AAGGGAGGGAAGGAGCACAGTGG + Intronic
1001400623 5:171444269-171444291 AAGTGAGGGGTGGGGTAGACAGG + Intronic
1001506568 5:172284259-172284281 AGGCGAGGGGAGGAGGAGAGAGG + Intergenic
1001538654 5:172520965-172520987 AAGAGAGTGGTGGAGAATAGTGG + Intergenic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1002078976 5:176726643-176726665 AAGTGAGCGGTGGAGAACAGGGG + Intergenic
1002300133 5:178253198-178253220 AAGGGAGGGGAGGAGTGTGGAGG - Intronic
1002327661 5:178420458-178420480 GGGGGAGGGGAGGAGGATAGAGG - Intronic
1002327717 5:178420609-178420631 CAGGGAGGGGAGGAGGAAAGGGG - Intronic
1002997155 6:2297547-2297569 ACGTGAGGGGTAGGGTATAGAGG + Intergenic
1003384380 6:5653859-5653881 GAGTGCGGGGAAGAGGATAGTGG + Intronic
1004302556 6:14471642-14471664 AAGTCAGGGGAGGATTATTTAGG - Intergenic
1004459514 6:15822668-15822690 AAGTGAGGAGAGGAGTGTTATGG - Intergenic
1005996828 6:30936678-30936700 AAGGGAGGGGAGGAGGATGATGG - Intergenic
1006328619 6:33373198-33373220 AAGTGACAGGAGGATTTTAGGGG - Intergenic
1007700697 6:43764827-43764849 GAGTGAGGGGAGGAGAGCAGAGG - Intergenic
1009282565 6:61770613-61770635 AAGTGAGAAGAGAAGTTTAGGGG + Intronic
1011407051 6:87026502-87026524 AAGTGAGGGGAGGGGGAAGGTGG + Intergenic
1012188204 6:96247942-96247964 AAGGGAGGGGAGTAGGAAAGAGG + Intergenic
1012853561 6:104475070-104475092 AAGTGAGGGATGGAGAAGAGAGG + Intergenic
1013652708 6:112212128-112212150 AACTCAGGTGAGGAGTATATGGG + Intronic
1013747337 6:113361247-113361269 AAGTCAGAGGAGGAGTGTTGTGG + Intergenic
1014265402 6:119271200-119271222 AAATTAGGGGAGGGGTATAGTGG - Intronic
1015885068 6:137909582-137909604 AAAAGAGGGAAGGAGTAGAGGGG + Intergenic
1018092484 6:160356954-160356976 TAGTGAGGGGTGAAGTTTAGGGG + Intronic
1022389783 7:29933451-29933473 TGGAGAGGGGAGGAGTAGAGAGG - Intronic
1022445467 7:30466952-30466974 AAGTGAGGGGTGGAGTGAGGTGG - Intronic
1022795332 7:33727349-33727371 AAGTGATGGGAGGAGTGTTTGGG + Intronic
1023002081 7:35820362-35820384 AAGGGAGGGAAGGAGAAAAGGGG - Intronic
1023311589 7:38892967-38892989 AAGAGATAGGAGGAGTGTAGAGG - Intronic
1025926907 7:65967630-65967652 AAGCGAGGGGAGCAGTGCAGTGG + Intronic
1026222803 7:68415207-68415229 AAGTGAGGGGAGGAGCTAAGGGG - Intergenic
1026630442 7:72033305-72033327 AAGGGAGGAGAGGAATATACAGG + Intronic
1026837545 7:73648428-73648450 AAGTGAGGGGAGAGGGAGAGAGG - Intergenic
1027674387 7:81141514-81141536 TAGAGAGGGGAAGAGTAAAGAGG + Intergenic
1028162378 7:87500122-87500144 AAGAGAGGGAGGGAGAATAGAGG - Intergenic
1028882480 7:95895483-95895505 ACTTGAGATGAGGAGTATAGTGG - Intronic
1028962107 7:96761034-96761056 AAGTGAAGGGAGAAGTATTCAGG - Intergenic
1029504950 7:100957686-100957708 AAGTGAGGCTGGGAGTATTGTGG - Exonic
1030380038 7:108800930-108800952 AAGAGAGAGGAGGAGAAAAGAGG - Intergenic
1032378514 7:131449722-131449744 AAGTTGGGGGAGGAGTAAAAGGG - Intronic
1032572268 7:133012823-133012845 AAGGGAGGGGAGGAGAAGAGAGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035058998 7:156055367-156055389 AAGTGAGGGTAGGAGGGAAGGGG - Intergenic
1035418715 7:158709683-158709705 CAGTGAGGGGAGGGGAATGGTGG + Intergenic
1035656699 8:1313450-1313472 AATTAAGGGGGGGAGTATAGGGG - Intergenic
1038971551 8:32642140-32642162 AATGGAGAGGAGGAGTATAGAGG + Intronic
1040894343 8:52350087-52350109 AAGTGTGGGGATGAGCATGGAGG + Intronic
1041989936 8:63974971-63974993 ATGTGAGGGGAGGAGTTCCGGGG - Intergenic
1042356715 8:67836496-67836518 AAGAGAGGGGAGGAGAGGAGAGG - Intergenic
1042575485 8:70213614-70213636 CAGTGTGGGGAGGAGAATTGTGG + Intronic
1043212728 8:77545125-77545147 TAGAGAGGGGAGGAGAAGAGAGG - Intergenic
1043411794 8:80004913-80004935 AAGTGAGAAGAGAAGTTTAGAGG + Intronic
1043911793 8:85872989-85873011 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1045831858 8:106471177-106471199 AAGGGAAGGGTGGATTATAGAGG + Intronic
1047767767 8:128003278-128003300 AAGAGAGGAGAGGAGAAGAGAGG - Intergenic
1047919044 8:129614081-129614103 GAGTGAGGGTAGGAGAATAATGG - Intergenic
1048402830 8:134087947-134087969 AAGTGAAGGGAGGGGTTTGGAGG - Intergenic
1050044122 9:1525887-1525909 GAGTGAGGGGAAGATTAGAGGGG - Intergenic
1050052140 9:1613829-1613851 AACTGAGTGGAGCTGTATAGTGG + Intergenic
1050544901 9:6701441-6701463 CAGGGAGGGGAGTAGGATAGAGG + Intergenic
1050710459 9:8456325-8456347 TAGAGAGGGGAGGAGAAGAGAGG + Intronic
1050732684 9:8727441-8727463 AAGTGAGGGGAGGAAGGAAGAGG + Intronic
1051168633 9:14294893-14294915 AAGTGAGGGGTGCAGTTCAGTGG + Intronic
1051803243 9:20961145-20961167 AGGGGAGGGGAGGAGTGGAGAGG - Intronic
1051918851 9:22239848-22239870 AAGTGAGGGGAGTAGACAAGGGG - Intergenic
1052108501 9:24549430-24549452 GAATGAGGGGAGGAGGGTAGCGG + Intergenic
1054787002 9:69219841-69219863 AAGTGGGGGGTGGGGTAGAGGGG - Intronic
1056065068 9:82925189-82925211 AAGGGAGGGGAGGATTATACAGG - Intergenic
1056416980 9:86386323-86386345 ATGTGAGGGGAGGCATCTAGTGG - Intergenic
1056991278 9:91413689-91413711 AAATGAGTGGAGAAGTAAAGAGG + Intronic
1057117492 9:92539657-92539679 AAGTGAGGGGAGGAGTAGTATGG + Intronic
1058573594 9:106375310-106375332 TAGAGAGGGGAGAAGTTTAGGGG - Intergenic
1058973289 9:110102590-110102612 AGGGGAGGGGAGGAGTGGAGAGG - Intronic
1059592144 9:115673107-115673129 AAGTGAGGCGAGGGGGAAAGAGG + Intergenic
1059865162 9:118505959-118505981 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1062155903 9:135048431-135048453 AAATGAGGGGAGGAGTGAGGCGG - Intergenic
1185587058 X:1248281-1248303 AAGGGAGGGGAGGGGAATGGAGG + Intergenic
1185688211 X:1948064-1948086 AAGACAGGGGAGGAGGAGAGGGG + Intergenic
1185688500 X:2133603-2133625 AAGACAGGGGAGGAGGAGAGGGG + Intergenic
1185915025 X:4025753-4025775 AAGGGAGGGGAGGAGAGGAGAGG - Intergenic
1186426615 X:9467713-9467735 AAGTGAGGGCGGGAGTGGAGGGG - Intronic
1188163803 X:26836185-26836207 AAGCTAGGGGAGGAGGAAAGGGG - Intergenic
1188201100 X:27293582-27293604 AAGTCTGGGGAGGAGGAGAGAGG + Intergenic
1188919038 X:35948834-35948856 TAGTGATGGGAGTAGCATAGAGG + Intronic
1189250490 X:39597563-39597585 ATGTGAAGGGAGGAATAGAGAGG - Intergenic
1191944488 X:66516986-66517008 AAGTGAGGAGATCAGTAAAGTGG - Intergenic
1192004093 X:67191157-67191179 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1193770764 X:85584575-85584597 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic
1194914798 X:99692501-99692523 AAGTAAGAGTAGGAGAATAGAGG - Intergenic
1195759868 X:108234884-108234906 AAGTGAGGTCATGAGTAGAGAGG + Intronic
1198495646 X:137189904-137189926 AAGTGAGAGGAAGAGTAAAATGG + Intergenic
1199980124 X:152916304-152916326 GAGTTAGGGGAGGAGTCAAGGGG - Intronic
1200751116 Y:6945160-6945182 AGGGGAGGGGAGGAGAAGAGAGG - Intronic
1201103522 Y:10746432-10746454 AAGTGTGGAGAGGAGTACAGTGG - Intergenic
1201147288 Y:11072283-11072305 AGGTGCGGGGAGGAGAACAGTGG - Intergenic
1202333501 Y:23780267-23780289 AAGTGAGAAGAGAAGTTTAGAGG - Intergenic
1202537268 Y:25889796-25889818 AAGTGAGAAGAGAAGTTTAGAGG + Intergenic