ID: 951502983

View in Genome Browser
Species Human (GRCh38)
Location 3:23411176-23411198
Sequence ACCCACAGCCTCAACTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951502983_951502988 16 Left 951502983 3:23411176-23411198 CCGCCTCAGTTGAGGCTGTGGGT 0: 1
1: 0
2: 2
3: 12
4: 161
Right 951502988 3:23411215-23411237 CTGAACTGTTGATAAAAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 184
951502983_951502989 17 Left 951502983 3:23411176-23411198 CCGCCTCAGTTGAGGCTGTGGGT 0: 1
1: 0
2: 2
3: 12
4: 161
Right 951502989 3:23411216-23411238 TGAACTGTTGATAAAAGTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951502983 Original CRISPR ACCCACAGCCTCAACTGAGG CGG (reversed) Intronic
900373777 1:2344148-2344170 CCCCACAGCCACGGCTGAGGAGG + Intronic
903443056 1:23402599-23402621 ACCATCAGCCTCAGCTGAGGTGG - Intronic
905385925 1:37604182-37604204 ACCCACAGCCTCAAGAGACTTGG + Intergenic
906733275 1:48101448-48101470 GCCCACATCCTGAACTGAGAGGG + Intergenic
907920429 1:58906302-58906324 ACCCCCAGCCCCCACTGATGGGG + Intergenic
909864598 1:80651695-80651717 ACCCACTGCTTCTACTGGGGTGG + Intergenic
910818630 1:91320804-91320826 TGCCACAGCCTCAGGTGAGGTGG + Intronic
911091354 1:94019732-94019754 AACCACAGCATCCACTGAAGTGG + Exonic
911871055 1:103099888-103099910 ACCAACAGCATAATCTGAGGAGG + Intronic
912688075 1:111782559-111782581 AGCCACATCCTCAAATGATGAGG - Intronic
913172734 1:116247335-116247357 ACCCAGAAGCTCAAGTGAGGGGG + Intergenic
915463998 1:156085340-156085362 ACCCCCTCCCTCAACTGAGAAGG + Intronic
919992455 1:202717967-202717989 AGCCTCAGTCCCAACTGAGGTGG + Intergenic
920164105 1:204023539-204023561 ACCCACAGCTTAAGCTAAGGGGG + Intergenic
920625104 1:207589285-207589307 AGCCATTGCCTCAACTGAGAAGG + Intronic
923291078 1:232546883-232546905 ACTCAGATCCTCAAATGAGGAGG + Intronic
923435513 1:233964320-233964342 ACCCACAGTCTCTTCTGAAGTGG + Intronic
1067805096 10:49386666-49386688 ACCCACAGCCTCACCTCTGCTGG + Exonic
1067896056 10:50180659-50180681 ACCCACAGCCTATACTGAATGGG - Intergenic
1067952922 10:50761340-50761362 ACCCACAGCCTATACTGAATGGG + Intronic
1068640046 10:59393499-59393521 ACCCACAGTCCAAACTGAGCTGG - Intergenic
1073459167 10:103656210-103656232 ACCAACAGCCTCTGCTGAAGAGG + Intronic
1074381658 10:112985704-112985726 ACCCACAGCCTCGCCCCAGGAGG - Intronic
1075671282 10:124265528-124265550 ACCCACACCCTCCACTGGGAGGG - Intergenic
1078923530 11:15853492-15853514 ACCAACAGCCTCAAATGCTGTGG + Intergenic
1080642738 11:34167173-34167195 AGCCCCAGCCTCAGCTGAGTGGG - Intronic
1081311400 11:41578395-41578417 ACGCACAGCCTCTTCTGAGCAGG - Intergenic
1081885472 11:46492159-46492181 CCTGACAGCCTCATCTGAGGAGG - Intronic
1082797459 11:57388434-57388456 ACCCACAGACAACACTGAGGGGG - Intronic
1083294885 11:61709968-61709990 ACCCACAGCCTGAGGAGAGGAGG + Intronic
1083700874 11:64476990-64477012 ACAAACAGCCTCAGCAGAGGGGG - Intergenic
1083754002 11:64779198-64779220 ACCTGCAGCGTCAACTGAGCCGG - Intergenic
1083815468 11:65130270-65130292 AGCCACAGCCTCTCCTGAGCTGG + Exonic
1084698420 11:70770123-70770145 ACCCACATACTCAGCTGAGAAGG - Intronic
1085228757 11:74946687-74946709 ACTCACAGCCTGTAGTGAGGTGG - Intronic
1086898968 11:92344850-92344872 TCCCCCAGCCTTATCTGAGGGGG - Intergenic
1092256469 12:6928679-6928701 ACCCGCAGACTCAAAAGAGGAGG + Intronic
1092494681 12:8980802-8980824 ACCCACAGCCTTAACTGCCAAGG - Intronic
1093173612 12:15886075-15886097 ACCTAAAGCCTTAACTGAGGAGG - Intronic
1093180930 12:15966237-15966259 ACTCCCAACCTCAAGTGAGGAGG - Intronic
1097233920 12:57527219-57527241 ACCCCCATCCTCACCTGGGGGGG - Exonic
1098545589 12:71707715-71707737 ACCCTCACCCTCCACTGAGGTGG - Intergenic
1101674821 12:106908141-106908163 CACCCCAGCCTCAGCTGAGGTGG + Intergenic
1102448545 12:113023091-113023113 ACCCACAGGAGCAACTGGGGAGG - Intergenic
1103630080 12:122252988-122253010 GTCCACAGCCAGAACTGAGGGGG + Intronic
1108720610 13:53127650-53127672 TCCCCCAGCCTCAACTGTAGAGG + Intergenic
1109610231 13:64755850-64755872 ACCCACTGCCTAGACTGAGCTGG + Intergenic
1110609248 13:77470720-77470742 ATCCTCATCCTCAACTGAGGGGG - Intergenic
1111487897 13:88927329-88927351 AGCCCCAGCCTCTACTGAGTTGG - Intergenic
1113636193 13:111920573-111920595 CCCCACTGCCTCAACAGACGGGG - Intergenic
1114443261 14:22767993-22768015 ACCCACAGCAGTACCTGAGGTGG + Exonic
1114629671 14:24151066-24151088 ACCCTCAGCCTGAACTAAGATGG - Intronic
1118983322 14:70733141-70733163 ACCAACAGCCTCAAGCGGGGCGG - Exonic
1119475151 14:74922849-74922871 ACCCACAGCCTCAGCCGGCGGGG + Intronic
1121937665 14:98035168-98035190 ACCCACAGCCTCACCACAGATGG + Intergenic
1122014917 14:98787096-98787118 ACTCACAGCCTCAGCAGGGGAGG - Intergenic
1122416334 14:101551365-101551387 ACCCCCCACCTCCACTGAGGGGG + Intergenic
1122777829 14:104130562-104130584 ACACACAGCCTCTACTCATGAGG + Intergenic
1123219656 14:106843980-106844002 TCCCCCAGCCTCAACTAAGAAGG - Intergenic
1124425694 15:29560688-29560710 CCCCACAGCCTCATCTAGGGAGG + Intronic
1124486884 15:30125606-30125628 TCCCTCACCCTCAACTGTGGGGG + Intergenic
1124541966 15:30594583-30594605 TCCCTCACCCTCAACTGTGGGGG + Intergenic
1124756641 15:32412717-32412739 TCCCTCACCCTCAACTGTGGGGG - Intergenic
1125252757 15:37724739-37724761 ACCAAAAGCCTGAAATGAGGAGG - Intergenic
1128693542 15:69743719-69743741 AAACACAGCCTGAAATGAGGAGG - Intergenic
1128794197 15:70452800-70452822 ACCCATAGTCCCAGCTGAGGAGG - Intergenic
1129044555 15:72722428-72722450 ACCCACAGCCCCTGCTGAGAGGG - Intronic
1133059538 16:3165417-3165439 ACCCACAGTCTCAGCTGAACTGG - Intergenic
1137334468 16:47533938-47533960 GCCCACAGCCACAACTTGGGCGG + Intronic
1138374376 16:56552621-56552643 ACCCACAGGCACTACTGATGGGG + Intergenic
1138559423 16:57791734-57791756 ACCCACAGCCTCGAGTTGGGTGG - Intronic
1143390209 17:6555806-6555828 ACGCAAAGCCTCAGCTGCGGAGG - Intronic
1144679643 17:17184402-17184424 CCTGACAGCCTCAGCTGAGGAGG - Intronic
1145254286 17:21314267-21314289 CCCCACAGCCCCATCTGCGGGGG + Exonic
1146136430 17:30324991-30325013 ACCCCCAGGCTCAAATGATGTGG - Exonic
1150537445 17:66057791-66057813 ACACACAGCCTTCAGTGAGGGGG + Intronic
1151756143 17:76076336-76076358 AACCACAGTCTCCACTGAGAGGG - Intronic
1151819590 17:76490386-76490408 AGCCACAGCTTCAACCGAGTGGG - Intronic
1152822488 17:82444433-82444455 TCCCACAGCCTTACCTGCGGTGG + Exonic
1153102942 18:1495101-1495123 ACCCACAGGCTCAAAGGAGAGGG - Intergenic
1155446861 18:25921890-25921912 TCACCCAGCCTCAACTGAGGAGG - Intergenic
1159575460 18:70170638-70170660 ACCCAAAGCCTTAACTGATCTGG - Intronic
1160862333 19:1242672-1242694 TCTCGCAGCCTCAACTGAGACGG - Intronic
1163724705 19:18915951-18915973 AACCTCAGCCCCACCTGAGGTGG - Intronic
1164292932 19:23883563-23883585 ACCCACAGCCCCAGATGATGTGG - Intergenic
1164753334 19:30671764-30671786 ACAAACAGCCTCAACTTGGGTGG + Intronic
1165091109 19:33388840-33388862 ACTCACAGGCACAGCTGAGGGGG + Intronic
1167597024 19:50433120-50433142 ACCCTCACCCTAAACTGATGCGG - Intronic
927074608 2:19565266-19565288 CCCCAGAGACTCAACTGAGTTGG + Intergenic
927560559 2:24069480-24069502 ACCCAGAGCCTGAACTGAGTGGG - Intronic
929765858 2:44843698-44843720 ACCCACATCCACAACTGGAGGGG - Intergenic
932180910 2:69644697-69644719 ACCCACAGCGTCAGCAAAGGAGG - Intronic
934620309 2:95799504-95799526 ACCCACAGCCTCTACTAGAGGGG - Intergenic
934640584 2:96025059-96025081 ACCCACAGCCTCTACTAGAGGGG + Intronic
935332595 2:101988067-101988089 AAGCACAGCCTCAGCTGTGGTGG + Intergenic
937064787 2:119009814-119009836 ACCGAAAGCCTGAACTCAGGAGG - Intergenic
941605653 2:167593689-167593711 TCCAACAGCATGAACTGAGGTGG + Intergenic
941844197 2:170117382-170117404 ACCCACAGCCCCAGATGATGTGG + Intergenic
942674038 2:178407623-178407645 ACCCACAGCCTCTACAGCAGGGG - Intergenic
944559271 2:200918952-200918974 ACCCATAGTCTCAGCTGAGGAGG - Intronic
948011436 2:234652183-234652205 CCACACAGCCTTTACTGAGGAGG + Intergenic
949020940 2:241741077-241741099 TCCCACATCCTCAGGTGAGGTGG + Exonic
1169052901 20:2595648-2595670 ACCCCCAGCCACAGCTGATGGGG - Intronic
1171517228 20:25747249-25747271 ACCCACACCCTCCACTGGGATGG - Intergenic
1172648876 20:36489168-36489190 ACACACAACCCCAGCTGAGGTGG - Intronic
1175484893 20:59338836-59338858 ACCCCCAGCCTCAAGTGAGGAGG + Intergenic
1175487955 20:59358795-59358817 ACCCCCAGCCTCAAGTGAGGAGG - Intergenic
1176086323 20:63297142-63297164 ACCCACACTCCCCACTGAGGCGG + Intronic
1179030924 21:37718929-37718951 ACCCACGGCCTCACCTGGGAGGG - Intronic
1179625955 21:42649956-42649978 ACCCAAGGCCTGAGCTGAGGAGG + Intergenic
1179884895 21:44309681-44309703 ACCCACAGCCCCACCTGAGCAGG - Intronic
1182091259 22:27596526-27596548 ACTCAAAGCCTCCACTGTGGTGG + Intergenic
1184866226 22:47203113-47203135 ACCCACAGCCTCCAGCGTGGGGG + Intergenic
950345094 3:12286699-12286721 ATCCACAGTCTCCACTCAGGCGG - Intergenic
951258994 3:20483896-20483918 ACCCACAGGCTCAAAATAGGGGG + Intergenic
951502983 3:23411176-23411198 ACCCACAGCCTCAACTGAGGCGG - Intronic
952717084 3:36490728-36490750 AGCATCAGCCTCAAATGAGGAGG - Intronic
955132981 3:56189007-56189029 ACCCACACCCCAAACTTAGGAGG + Intronic
955520612 3:59772110-59772132 ACCCACCTCCACCACTGAGGGGG + Intronic
964720189 3:159763130-159763152 ACCCACAGCCTGAACTTGGAAGG + Intronic
966209370 3:177436894-177436916 ACTCACAGCCTCAAATGTGTTGG + Intergenic
968497798 4:927845-927867 ACCCAGAGCCTGAAGTGCGGTGG - Intronic
969656049 4:8499161-8499183 ACCCAGAGCCACATCTCAGGAGG - Intergenic
977996037 4:103498169-103498191 AGCTACAGCCTCAACTGTGATGG + Intergenic
981453742 4:144929706-144929728 ACCCACAGCCACCACTGAATGGG - Intergenic
981576663 4:146213010-146213032 ACCCACAGCCTCTGCTGAGCCGG - Intergenic
985698874 5:1358669-1358691 ACTCCCAGCCCCACCTGAGGGGG + Intergenic
985733918 5:1566323-1566345 CCCGACAGCCTCCCCTGAGGTGG - Intergenic
987203871 5:15604814-15604836 AGCTACAGCCTCAACTGAGATGG - Intronic
987464593 5:18256728-18256750 ACCAACAGCCTCTGCTGAGAAGG + Intergenic
995457594 5:112368521-112368543 ACCAAGAGTCTCAAATGAGGAGG - Intronic
998129859 5:139646235-139646257 ACCCCCACCCCCAACTCAGGCGG - Intergenic
1001296645 5:170503617-170503639 ACCCACTGCCTGAACTCATGGGG - Intronic
1001957684 5:175859427-175859449 AGCCCCAGTCCCAACTGAGGAGG + Intronic
1004800895 6:19146065-19146087 ACCCACAGCCTCACATTATGTGG + Intergenic
1006600901 6:35225200-35225222 ACTCACAGCCTCTCATGAGGAGG + Intronic
1007051641 6:38836843-38836865 ACCCACAGCATCAGCTGAACAGG - Intronic
1007398693 6:41591475-41591497 ATCCACAGCCCCTGCTGAGGTGG - Intronic
1007429477 6:41768412-41768434 ACCCACCACCCCAACTGTGGAGG + Intergenic
1017289714 6:152721894-152721916 ACCCACGGCCTCAACAGAACTGG + Exonic
1017901406 6:158721187-158721209 AGCCACAACCTCAATTAAGGTGG - Intronic
1018669283 6:166166596-166166618 ACCAACAAGCTCAACGGAGGGGG - Exonic
1022895970 7:34750792-34750814 CCACACAGCCTAAACTGAGCAGG - Intronic
1024270861 7:47640384-47640406 GCCCACAGCGCCAGCTGAGGTGG + Intergenic
1029460227 7:100690001-100690023 GTCCAGAGCCTCAACTGAGGAGG + Intergenic
1030818950 7:114073269-114073291 ACCCAAAGCCAATACTGAGGAGG + Intronic
1033172377 7:139095540-139095562 AGCCACAGCCTGCACCGAGGAGG + Intronic
1036048252 8:5167518-5167540 ACCCTGAGCCTCCACTGAGCTGG + Intergenic
1037918784 8:22789513-22789535 GCCCACAGCCCCACCTCAGGGGG - Intronic
1038455845 8:27671334-27671356 AGCCAGAGCTTCTACTGAGGAGG + Exonic
1040413546 8:47178786-47178808 CCCCACAGCCCCAGTTGAGGAGG - Intergenic
1040535940 8:48309719-48309741 ATCCACAGCCTGGACTGAGCTGG - Intergenic
1046555678 8:115769441-115769463 GACCACAGCCTGAGCTGAGGAGG - Intronic
1048787258 8:138063432-138063454 ACACACAGCATCAAGGGAGGGGG + Intergenic
1051433975 9:17010856-17010878 ACCCACAGCCTCTGATCAGGAGG - Intergenic
1054767606 9:69055229-69055251 ATCCACAGCCTGATCAGAGGTGG + Intronic
1055194199 9:73567148-73567170 ACCCACACCCTCAAAGAAGGGGG + Intergenic
1060507027 9:124205519-124205541 ATGCAAAGCCTCACCTGAGGTGG - Intergenic
1060580948 9:124746046-124746068 ATCAACAGCTTCAACTGAAGGGG + Intronic
1061395430 9:130341195-130341217 ACCCAGAGCCCCAGCTGAGCTGG + Intronic
1062256504 9:135625151-135625173 GCCCACAGCTTCAGCTGAGTTGG + Intronic
1062393589 9:136343608-136343630 GCCCACAGCCTAAACTGCAGGGG - Intronic
1186504744 X:10082215-10082237 ACACACAGTCGCATCTGAGGAGG - Intronic
1188840188 X:35007572-35007594 ACCCACAGCCTCAAGAAATGTGG + Intergenic
1190265049 X:48823209-48823231 CCCGACAGCCTCCTCTGAGGTGG - Exonic
1190265061 X:48823251-48823273 TCCCACAGTCTCCTCTGAGGTGG - Exonic
1190445475 X:50519695-50519717 TGCCACAGCCCCCACTGAGGTGG - Intergenic
1192737333 X:73861855-73861877 CCCCACAGCCTTAACTGCTGAGG - Intergenic
1197261269 X:124320831-124320853 AGCCACAGCAGTAACTGAGGTGG - Intronic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1197951990 X:131907983-131908005 ATCCACAGCCGCAATTTAGGTGG - Intergenic
1198080503 X:133235171-133235193 TTCCACAGACTCAACTGATGTGG - Intergenic
1200967852 Y:9117197-9117219 ACCCACAGCCCCAAATGATGTGG - Intergenic
1202142911 Y:21746892-21746914 ACCCACAGCCCCAGATGATGTGG + Intergenic
1202143947 Y:21758726-21758748 ACCCACAGCCCCAGATGATGTGG - Intergenic
1202589346 Y:26466159-26466181 GCCTACAGCCTCAAGTCAGGTGG - Intergenic