ID: 951509875

View in Genome Browser
Species Human (GRCh38)
Location 3:23488575-23488597
Sequence TTATGCAATTAGAATGATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951509875 Original CRISPR TTATGCAATTAGAATGATAC CGG Intronic
906583697 1:46957210-46957232 TGAAGCAGTTAAAATGATACAGG + Intergenic
909088864 1:71201173-71201195 TTCTGCCATTTGAATGAAACAGG + Intergenic
909173651 1:72326201-72326223 TTTTGGTATCAGAATGATACTGG - Intergenic
909789707 1:79660297-79660319 TTATGCAAATAGATTGATGAAGG + Intergenic
909853842 1:80503710-80503732 TTATGCATTAAGAATGATCTAGG - Intergenic
910591322 1:88930202-88930224 TGAAGCAGTTAAAATGATACAGG + Intergenic
910663357 1:89697512-89697534 TTATGCTCTTAAAATAATACAGG - Intronic
910804772 1:91179447-91179469 TGAAGCAGTTAAAATGATACAGG + Intergenic
910813132 1:91258070-91258092 TTTTGCAATCAGGAAGATACGGG - Intergenic
912101991 1:106220753-106220775 TAATCAAATTAGCATGATACTGG + Intergenic
912389238 1:109290471-109290493 CTATGCAATTAGAATGTTACTGG - Intergenic
914979879 1:152404649-152404671 TTATGCAGTTAGAAAGAAAGAGG - Intergenic
916743365 1:167665196-167665218 TTATGTAAATAGAACCATACGGG + Intronic
916902949 1:169249960-169249982 TTGTGGTATCAGAATGATACTGG + Intronic
917059416 1:171020269-171020291 TTTTGGAATCAGAATGATGCTGG - Intronic
917228500 1:172810490-172810512 TTTTGATATCAGAATGATACTGG + Intergenic
917572636 1:176284743-176284765 TTTTGATATTAGAATGATGCTGG + Intergenic
919110783 1:193216599-193216621 TTTTGGTATTAGAATGATGCTGG - Intronic
920423753 1:205856447-205856469 TTTTGCTATTAGGGTGATACTGG - Intergenic
921116428 1:212095859-212095881 TTTTGGTATTAGAGTGATACTGG + Intronic
921494021 1:215814053-215814075 TTATAAAATTCGAATGATCCTGG - Intronic
921496696 1:215851694-215851716 TTTTGGTATTAGAATGATATTGG - Intronic
921777399 1:219117483-219117505 TTTTGGTATTAGAATGATGCTGG - Intergenic
922684408 1:227628129-227628151 TGAAGCAGTTAAAATGATACAGG - Intronic
923181650 1:231526164-231526186 ATAGGCAATTAGAATGCAACAGG + Intergenic
923635813 1:235695155-235695177 TTAAGCACTTAGAATGAACCAGG + Intronic
924629955 1:245727671-245727693 TTTTGGTATTAGAATGATGCTGG - Intergenic
1062917991 10:1256541-1256563 TTATGCACTCAGAATGCCACTGG - Intronic
1063234400 10:4097730-4097752 TTATGCAATGAGAATGAAGTTGG + Intergenic
1064465679 10:15578253-15578275 TTATATAATTGGAATCATACAGG + Intronic
1065065035 10:21953567-21953589 ATATGCATTTGGAAAGATACAGG + Intronic
1065344580 10:24736593-24736615 TTATGCAATTTAAATGTTTCTGG + Intergenic
1065392824 10:25201957-25201979 TTTTGGAATCAGAATGATGCTGG + Intronic
1066407415 10:35131635-35131657 TTCTGCACTTAGAAAGATACAGG + Intronic
1066613347 10:37273497-37273519 TTTTGGAATGAGAATGATTCTGG + Intronic
1066619463 10:37329652-37329674 TTTTGCTATTAGGATGATAATGG - Intronic
1067245902 10:44543207-44543229 TTTTGGTATTAGGATGATACTGG + Intergenic
1067896456 10:50185752-50185774 TTATTGAATTAGAATGAACCTGG - Exonic
1067952517 10:50756275-50756297 TTATTGAATTAGAATGAACCTGG + Intronic
1067960430 10:50841959-50841981 TTATGAAATGAGAATGATGATGG - Exonic
1068442743 10:57079725-57079747 TTTTGGTATTAGGATGATACTGG + Intergenic
1069119578 10:64552270-64552292 ATATGCAAGTGGAGTGATACAGG - Intergenic
1069262694 10:66418524-66418546 TTTTGGTATCAGAATGATACCGG - Intronic
1070192970 10:74129635-74129657 TTATTCAGTAAAAATGATACTGG + Intronic
1070994084 10:80760430-80760452 TTATGAAATTCGAATAATATAGG - Intergenic
1071122663 10:82297630-82297652 TTATGCATATGAAATGATACAGG + Intronic
1071323475 10:84488590-84488612 AGACGCAATTAAAATGATACAGG - Intronic
1071799805 10:89046418-89046440 TTTTGCTATCAGAATGATGCTGG + Intergenic
1072294509 10:93995977-93995999 TTATTCATTTAGAAAGTTACAGG - Intronic
1072394899 10:95028600-95028622 TTTTGCTATTAGGGTGATACTGG + Intergenic
1073332819 10:102681800-102681822 ATGTGTAATTAAAATGATACTGG - Intronic
1073900185 10:108211902-108211924 TTTTGGTATTAGAGTGATACTGG + Intergenic
1074209204 10:111313254-111313276 TTTTGCTATTAGGATGATGCTGG - Intergenic
1074702275 10:116102875-116102897 TTATACAAGTAGATTGATAAGGG - Intronic
1077833942 11:5907078-5907100 TTTTGATATTAGTATGATACTGG + Intronic
1079704791 11:23600820-23600842 TTTTGTTATTAGGATGATACTGG + Intergenic
1080353269 11:31410687-31410709 TTATGGAATTAGAAGGATTGAGG + Intronic
1080402593 11:31950507-31950529 TTATGGTATTAGGGTGATACTGG - Intronic
1080423084 11:32129861-32129883 TTTTGGTATTAGAATGATGCTGG - Intergenic
1080486211 11:32709697-32709719 TTTTGGTATTAGGATGATACTGG + Intronic
1081375565 11:42354105-42354127 TTATGGAATTAGAGTGACACAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085432455 11:76464957-76464979 ATCTGAAATTAGAATGGTACTGG - Intronic
1085966376 11:81532904-81532926 TTATGCATTTATGATGATGCTGG + Intergenic
1086079085 11:82884202-82884224 TTATTCAATCACAATGATGCTGG + Intronic
1086269445 11:85043489-85043511 TTATGTATTTATAATGATGCTGG - Intronic
1087602334 11:100332490-100332512 TTTTGGTATTAGGATGATACTGG - Intronic
1087908107 11:103723280-103723302 TTTTGGTATTAGAGTGATACTGG - Intergenic
1088034380 11:105294267-105294289 TTTTGGAATCAGGATGATACTGG + Intergenic
1088265303 11:107982800-107982822 TGAAGCAGTTAAAATGATACAGG - Intergenic
1088418346 11:109614805-109614827 TTTTGGAATCAGAATGATGCTGG - Intergenic
1088630542 11:111770041-111770063 TGATGCTATGAGAATGAAACAGG + Intergenic
1088962948 11:114688572-114688594 TTTTGATATCAGAATGATACTGG + Intronic
1090162265 11:124508205-124508227 TTTTGCTATCAGGATGATACTGG + Intergenic
1090682966 11:129081267-129081289 TTTTGGTATTAGAGTGATACTGG - Intronic
1090894716 11:130961127-130961149 TTTTGGTATTAGGATGATACTGG + Intergenic
1091271513 11:134315071-134315093 TTATGTAAATGGAATCATACAGG + Intronic
1091468319 12:704919-704941 TAATACAATTAAGATGATACAGG + Intergenic
1091645790 12:2271253-2271275 TTTTCCATTTAGAATGAAACTGG - Intronic
1092393867 12:8107358-8107380 TTTTGGAATCAGGATGATACTGG + Intergenic
1092575578 12:9778854-9778876 TTTTGGTATCAGAATGATACTGG + Intergenic
1093646662 12:21593767-21593789 TTATGGAATCAGGATAATACTGG - Intronic
1094110369 12:26855512-26855534 TTATGAATTCAGAATGAGACTGG - Intergenic
1094779275 12:33772351-33772373 CTATGCAGTTAGAATAATAATGG - Intergenic
1096033445 12:48441994-48442016 TTATGAAATCAGAATGATGAGGG - Intergenic
1096351795 12:50906901-50906923 TGAAGCAGTTAAAATGATACAGG - Intergenic
1097376975 12:58853973-58853995 TGAAGCAGTTAAAATGATACAGG - Intergenic
1097496504 12:60344928-60344950 TTATACAGTTAGAATTATATTGG + Intergenic
1097558945 12:61177129-61177151 TTTTGCTATCAGAATGATACTGG + Intergenic
1097623223 12:61966673-61966695 TTATGCAATTAAATTGAAAAAGG + Intronic
1098009465 12:66034926-66034948 TTATGAAAATAGAATAATAAAGG + Intergenic
1098562668 12:71893344-71893366 TAATGCAGTCAGAATAATACAGG - Intronic
1098776620 12:74628775-74628797 TTCTACATTTAGAATTATACTGG + Intergenic
1099108235 12:78522597-78522619 TTTTGGAATCAGAATGATGCTGG - Intergenic
1099162244 12:79257237-79257259 TTATGGTATGAGAAGGATACAGG - Intronic
1099246487 12:80198611-80198633 TTATTTATTTAGAAGGATACAGG - Intergenic
1099457207 12:82878533-82878555 GTTTACAAATAGAATGATACAGG + Intronic
1099476874 12:83118657-83118679 TTTTGGTATTAGAGTGATACTGG + Intronic
1099726711 12:86440129-86440151 CTTTGTTATTAGAATGATACTGG - Intronic
1099771546 12:87065035-87065057 TTTTGGTATCAGAATGATACTGG - Intergenic
1100412613 12:94336724-94336746 TTATGAAATAAGAATGTGACTGG - Intronic
1100421582 12:94439696-94439718 TTTTGCTATTAGGATAATACTGG - Intronic
1100921206 12:99489353-99489375 TGCTGCAATAAGTATGATACGGG + Intronic
1101651285 12:106679571-106679593 GTATGCACTTATATTGATACTGG + Intronic
1102345222 12:112155691-112155713 TTTTGGTATTAGAATGATGCTGG + Intergenic
1102884776 12:116513190-116513212 TTGTGCTGTCAGAATGATACAGG - Intergenic
1103803390 12:123554204-123554226 TGAAGCAGTTAAAATGATACAGG + Intergenic
1105476927 13:20736226-20736248 ATAAGAAATCAGAATGATACTGG + Intronic
1105598584 13:21863958-21863980 TTTTGGTATTAGAGTGATACTGG + Intergenic
1105751577 13:23425885-23425907 TTATACAATTGGAATGATACTGG + Intronic
1106604865 13:31219101-31219123 TTTTGGTATCAGAATGATACTGG - Intronic
1108113826 13:47106269-47106291 TTTTGGAATCAGAATGATGCTGG - Intergenic
1108146745 13:47485353-47485375 TTATGGAATTAGTAGTATACAGG - Intergenic
1108851871 13:54739969-54739991 TTTTGGTATTAGAATGATGCTGG + Intergenic
1109001691 13:56812697-56812719 TTATGGGGTTGGAATGATACAGG - Intergenic
1109253315 13:60047462-60047484 TAATCAAATTAGAGTGATACAGG + Intronic
1110018121 13:70434414-70434436 AAATGCAATTAGAATGACAGTGG + Intergenic
1110349479 13:74490573-74490595 TTTTGCTATTAGGATGATACTGG + Intergenic
1111318841 13:86596914-86596936 TCATGCAAATAGAATCATACAGG - Intergenic
1112250830 13:97778164-97778186 TTTTGGAATTAGGGTGATACTGG + Intergenic
1114969067 14:28002676-28002698 TTTTGGTATCAGAATGATACTGG + Intergenic
1115172084 14:30520047-30520069 TTATGTAATTGTATTGATACAGG + Intergenic
1115182594 14:30646605-30646627 TTTTGGTATGAGAATGATACTGG + Intronic
1115684319 14:35779217-35779239 TTATGAAATTAGAATAAAACAGG + Intronic
1117826989 14:59714339-59714361 TTATCCCATTAGAATAATGCTGG + Intronic
1117894220 14:60463506-60463528 TTCTGGAATTAGAGTGATAATGG + Intronic
1117924460 14:60763308-60763330 TTATTCATTTAAAATGATATAGG - Intronic
1118068654 14:62220759-62220781 TTTTGGTATCAGAATGATACTGG + Intergenic
1120296578 14:82648961-82648983 TTAACCAATTAGACTGATAGTGG - Intergenic
1123820140 15:24021161-24021183 TTTTGCTATCAGGATGATACTGG - Intergenic
1123928670 15:25145271-25145293 GTTTGGAATTAGAATGAGACTGG + Intergenic
1124050560 15:26193499-26193521 TTATGTATTTGGAATGATAAAGG - Intergenic
1124511669 15:30332527-30332549 ATTTGTAATTAAAATGATACTGG - Intergenic
1124731245 15:32198230-32198252 ATTTGTAATTAAAATGATACTGG + Intergenic
1125316384 15:38436623-38436645 TTTTGTTATCAGAATGATACTGG + Intergenic
1127651135 15:61008917-61008939 TGATGAAATTAGAAAGACACGGG + Intronic
1128197846 15:65776591-65776613 TTATGGAAGGGGAATGATACAGG - Intronic
1128597159 15:68963513-68963535 TTTTGGTATCAGAATGATACTGG + Intronic
1138358221 16:56402706-56402728 TCATGTACTTAGAATGGTACTGG - Intronic
1138719454 16:59061995-59062017 TAATGTAATTGGAATCATACAGG - Intergenic
1138871797 16:60897892-60897914 TTATGTAAATGGAATGATATTGG - Intergenic
1141221702 16:82075870-82075892 TTTTGCTATCAGAATGATATAGG - Intronic
1142647105 17:1321497-1321519 TTAAGAAAGTAGAATGATAAAGG + Intergenic
1142910499 17:3086027-3086049 TTTTGGTATTAGAGTGATACTGG + Intergenic
1143989861 17:10947975-10947997 TTAAGGAAGAAGAATGATACGGG + Intergenic
1149221680 17:54421828-54421850 TTTTGGTATTAGGATGATACTGG - Intergenic
1150907828 17:69357270-69357292 TTATGCAATTTGAATTAAACTGG - Intergenic
1151122885 17:71812173-71812195 TTTTGGTATTAGAATGATGCTGG - Intergenic
1153221945 18:2869499-2869521 TTATGTAAATAGAGTCATACAGG + Intronic
1153401830 18:4690355-4690377 TGAAGCAGTTAAAATGATACAGG + Intergenic
1154392886 18:13956893-13956915 TTTTGCTATCAGAATGATGCTGG - Intergenic
1155535387 18:26811291-26811313 TTTTGTAATTAGGAGGATACTGG + Intergenic
1156393740 18:36678237-36678259 TTCAGCATTAAGAATGATACTGG + Intronic
1156672645 18:39489320-39489342 TTATTGTATTAGAATCATACTGG - Intergenic
1157839443 18:50942937-50942959 TTAAGCAATTAGGTTGATAAGGG + Intronic
1157997732 18:52579326-52579348 ATATGCAATTAGAAAGTTACAGG + Intronic
1158907552 18:62028574-62028596 TTAAGTAATTAGAATCATAATGG - Intergenic
1159212753 18:65348333-65348355 ATACACAATTAAAATGATACAGG - Intergenic
1159217074 18:65406925-65406947 TTATGCAATTATTATCCTACTGG + Intergenic
1159302644 18:66595821-66595843 TTTTGGTATTAGAATGATGCCGG - Intronic
1164142125 19:22480358-22480380 TTTTGGTATTAGAATGATGCTGG - Intronic
1164267776 19:23636921-23636943 TTTTGGCATTAAAATGATACTGG - Intronic
1164408159 19:27973112-27973134 AAAAGCAATTAGAGTGATACAGG + Intergenic
1165642217 19:37399394-37399416 TGAAGCATTAAGAATGATACTGG - Intergenic
1167865507 19:52323456-52323478 TTTTGGTATTAGAATGATGCTGG - Exonic
927817240 2:26229608-26229630 TTATGCATGGATAATGATACAGG + Intronic
928352907 2:30578495-30578517 TAATGCAATGAGAAAAATACAGG - Intronic
928677373 2:33662779-33662801 TGAAGCAGTTAAAATGATACAGG + Intergenic
929475247 2:42240271-42240293 TTGTGAAATTCGAATAATACAGG + Intronic
931752527 2:65343095-65343117 TTCTTCAATTACAATTATACAGG + Intronic
931912708 2:66919112-66919134 CTATGCACTAAGAATCATACTGG + Intergenic
932844959 2:75125483-75125505 ATATGCAATTAGAAAAATAAAGG - Intronic
933023441 2:77223244-77223266 TTGTGCATTCAGTATGATACTGG - Intronic
933181547 2:79232524-79232546 TTTTGCTATCAGAATGATGCTGG + Intronic
933340706 2:81022458-81022480 TTTTGGTATTAGAATGATACTGG + Intergenic
934468870 2:94496706-94496728 TTTTGGAATCAGAATGATGCTGG - Intergenic
934923079 2:98361498-98361520 TTATTCTATTATAAAGATACAGG - Intronic
936005107 2:108879422-108879444 TTATGCAGTTAGCATGAATCTGG + Intronic
936141160 2:109942371-109942393 TTTTGGAATTAGGATGATACTGG - Intergenic
936177848 2:110240316-110240338 TTTTGGAATTAGGATGATACTGG - Intergenic
936203533 2:110429115-110429137 TTTTGGAATTAGGATGATACTGG + Intronic
936811700 2:116410205-116410227 TTAAGCAATCAGAATGGTCCTGG - Intergenic
937498870 2:122455635-122455657 TTTTGGTATTAGGATGATACTGG - Intergenic
937526431 2:122775740-122775762 TTTTGGAATCAGGATGATACTGG - Intergenic
937828666 2:126396132-126396154 TTTTGGTATTAGATTGATACTGG + Intergenic
939904416 2:147893139-147893161 TTATGTAAATGGAATCATACGGG + Intronic
939919415 2:148090345-148090367 TTTTGGTATTAGGATGATACTGG - Intronic
940297884 2:152147686-152147708 TTATAAAATAAGAATGATAAGGG + Intronic
940657128 2:156501373-156501395 TTATGGAATTAGAATGAACTTGG + Intronic
940658525 2:156518412-156518434 TTATACAATTAAATTGTTACAGG + Intronic
940953700 2:159705579-159705601 TTACAGAATTAGAATGCTACTGG + Intergenic
941050426 2:160726467-160726489 TTGTGGTATTAGCATGATACTGG - Intergenic
941755417 2:169180428-169180450 TTCTGCAATGAGAATGCTAAAGG + Intronic
941991501 2:171561651-171561673 TGAAGCAGTTAAAATGATACAGG - Intergenic
942951338 2:181725575-181725597 ATATGCTATTAGAATAGTACTGG + Intergenic
943139750 2:183967163-183967185 TTATGCACTTATAATGAAAAGGG - Intergenic
943391222 2:187270760-187270782 TACTAAAATTAGAATGATACAGG - Intergenic
943544857 2:189262666-189262688 TTATGTAATTAGAACAATATAGG - Intergenic
943568807 2:189547711-189547733 ATATTCAATTACAATGATGCTGG + Intergenic
944532582 2:200681821-200681843 TGATGCAATTCCAATGTTACTGG + Intergenic
944681444 2:202080751-202080773 TAAAGCACTTAGAATGGTACTGG - Intronic
945834981 2:214828772-214828794 TTAAGCAATGAGAATTATAGAGG + Intergenic
946129183 2:217592522-217592544 TGAAGCAATTAAAATGATACAGG - Intronic
947559737 2:231138284-231138306 TTATTCAACTAAAGTGATACTGG + Intronic
1169896391 20:10509254-10509276 TTATTCAATTATAAAGATAGTGG + Intronic
1170070789 20:12364158-12364180 TTTTGGTATCAGAATGATACCGG - Intergenic
1170221312 20:13944975-13944997 TCATGAAATTAAAATGAGACTGG + Intronic
1170378179 20:15725776-15725798 TTATTCAATGAGAATTTTACAGG - Intronic
1170489183 20:16854237-16854259 GTTTGGTATTAGAATGATACTGG + Intergenic
1171043995 20:21793295-21793317 TGAAGCAATTGGAATGGTACTGG + Intergenic
1171158704 20:22901182-22901204 TTTTGATATCAGAATGATACTGG - Intergenic
1173394562 20:42667181-42667203 TTATGCATTGATAATGATTCTGG + Intronic
1174991847 20:55519928-55519950 TTTTGCTATCAGAATGATGCTGG + Intergenic
1176525601 21:7865352-7865374 TTTTGGCATTAGGATGATACTGG + Intergenic
1177301533 21:19251688-19251710 TTTTGGTATTAGGATGATACTGG - Intergenic
1177694939 21:24558851-24558873 TTGTGCATTCAGTATGATACTGG - Intergenic
1177749947 21:25268719-25268741 TTTTGGTATTAGGATGATACTGG - Intergenic
1178659621 21:34495365-34495387 TTTTGGCATTAGGATGATACTGG + Intergenic
1179365088 21:40751553-40751575 TTATGTAATTAGAATCACAGAGG - Intronic
1180570297 22:16710229-16710251 TTTTGGAATCAGAATGATGCTGG - Intergenic
1183552204 22:38496133-38496155 TTTAGCATTTGGAATGATACTGG + Intronic
949323312 3:2836346-2836368 TTATGGAATGAGAATAATCCTGG + Intronic
949343966 3:3059425-3059447 GTAAGGAATTAGAATGACACAGG + Intergenic
950176054 3:10875221-10875243 TTATGCATTTAAAATTATTCTGG - Intronic
950252443 3:11477694-11477716 TTATGTAGTTGGAATGTTACTGG + Intronic
951083524 3:18481893-18481915 TTATGCAATTAAAAGGAAAAGGG - Intergenic
951432557 3:22625199-22625221 TTTTGGTATTAGAATGATGCTGG + Intergenic
951509875 3:23488575-23488597 TTATGCAATTAGAATGATACCGG + Intronic
951763938 3:26175955-26175977 TTTTGGTATTAGGATGATACTGG + Intergenic
952689563 3:36188936-36188958 TTTTGATATTAGGATGATACTGG + Intergenic
952693202 3:36234403-36234425 TTTTGGAATCAGGATGATACTGG - Intergenic
953721536 3:45360107-45360129 TTTTGGTATTAGAATGATGCTGG + Intergenic
954995150 3:54874587-54874609 TCATGAACTTAGAATGGTACTGG - Intronic
956244347 3:67164854-67164876 TTTTGGTATTAGAGTGATACTGG + Intergenic
956701582 3:71963890-71963912 TTATGCAATTAGCAAGAAATAGG - Intergenic
957108265 3:75919522-75919544 TTTTGGAATCAGAATGATGCTGG + Intronic
957287250 3:78232201-78232223 TTATTCAATTAGAATGAAAAGGG + Intergenic
957597334 3:82284301-82284323 TTAAGCAATTAAAATAATACTGG - Intergenic
958551369 3:95618046-95618068 TTTTGCTATTAGAAAGATGCTGG - Intergenic
958678890 3:97299958-97299980 TTATACTATAAGAATGAAACAGG - Intronic
958727712 3:97926075-97926097 TTTTGGTATTAGAATGATGCTGG - Intronic
958756027 3:98249943-98249965 TTAGGCCATTTTAATGATACTGG - Intergenic
958895168 3:99821345-99821367 CTATGCAATTAGAATTTTGCAGG + Intronic
958998239 3:100930847-100930869 TTTTGGTATTAGAATGATACTGG - Intronic
959124951 3:102279531-102279553 TTTTGGTATTAGGATGATACTGG + Intronic
959181887 3:102991601-102991623 TTTTGGTATTAGAATCATACTGG + Intergenic
959707532 3:109352243-109352265 TTAAGCAAGAAGAATGATAAGGG - Intergenic
959956842 3:112249445-112249467 TTTTGCTATTAGGATGATGCTGG + Intronic
960207040 3:114915063-114915085 TTTTGGTATTAGGATGATACTGG + Intronic
960789713 3:121415073-121415095 TGATGCAATTAAAATCATACTGG + Intronic
960981553 3:123232710-123232732 TTTTGGTATTAGTATGATACCGG - Intronic
961395821 3:126588827-126588849 TGATGCAATAAAAATGATAAAGG - Intronic
962147148 3:132852042-132852064 TTCTGGAATTAGGGTGATACTGG + Intergenic
962689450 3:137879140-137879162 TAATGCAATCAGCATGGTACTGG + Intergenic
962861900 3:139411193-139411215 TTTTGGAATTAGCATGATACTGG + Intergenic
963455731 3:145544218-145544240 TTATGGTATTAGAGTAATACTGG + Intergenic
964226738 3:154411854-154411876 TATTGGTATTAGAATGATACTGG - Intronic
964867843 3:161280927-161280949 TTTTGCTATTAGGGTGATACTGG - Intergenic
965013644 3:163128477-163128499 TTTTGGTATTAGAGTGATACTGG - Intergenic
965038426 3:163472586-163472608 TTTTGCTATCAGGATGATACTGG + Intergenic
965745713 3:171923447-171923469 TTTTGGTATTAGAGTGATACTGG - Intronic
966251401 3:177869283-177869305 TTTTGGAATCAGAATGATGCTGG - Intergenic
966389608 3:179438238-179438260 CTGTGGAATGAGAATGATACTGG - Intronic
966905363 3:184520367-184520389 TTATTCAAATAGAATGAGGCTGG - Intronic
969645248 4:8424533-8424555 TGAAGCAGTTAAAATGATACAGG + Intronic
970362072 4:15320272-15320294 GTATGTAAATAGAATGCTACAGG + Intergenic
970719110 4:18965520-18965542 TTATGCAATTGGGAAAATACTGG - Intergenic
971690128 4:29823223-29823245 TTTTGCTATCAGGATGATACTGG + Intergenic
972070171 4:35009345-35009367 TTATGTATTGAGAATGACACAGG - Intergenic
972098777 4:35384164-35384186 TTATGGAATTAGAATTCTAAGGG - Intergenic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
973034334 4:45387272-45387294 TTTTGAAATCAGAATGATGCTGG + Intergenic
973227606 4:47803405-47803427 CTATGCAAAAAGAATGAAACTGG + Intronic
973544780 4:51970054-51970076 TTCTGGTATTAGGATGATACTGG + Intergenic
973652451 4:53009766-53009788 AAATGCAATTAAAATGATAAAGG - Intronic
974195646 4:58570941-58570963 TTATACAACTTTAATGATACAGG - Intergenic
974239931 4:59233970-59233992 TTTTGCTATCAGAATAATACTGG + Intergenic
974415849 4:61606005-61606027 AGATGCAATGAGAGTGATACAGG + Intronic
974533995 4:63151105-63151127 TTTTGCTATTAGGGTGATACTGG + Intergenic
974536469 4:63181694-63181716 ATATGCAATAAAAATGATAAAGG - Intergenic
974593656 4:63988493-63988515 TTTTGGTATTAGGATGATACTGG - Intergenic
975080841 4:70278629-70278651 TTAAGCAATTAGAATAATCTTGG + Intergenic
975510065 4:75184556-75184578 TTTTGGAATTAGGGTGATACTGG - Intergenic
975779384 4:77822447-77822469 ATTTGCAATTAGAATGACATTGG + Intergenic
975787959 4:77913871-77913893 TTATACAAAAAGAATCATACAGG - Intronic
976556494 4:86456812-86456834 TTTTGGTATTAGAGTGATACTGG - Intronic
976669845 4:87639920-87639942 TTTTGGAATTAGGATGATGCTGG - Intergenic
976716355 4:88126432-88126454 TTTTGGTATTAGAATGATGCTGG - Intronic
976758061 4:88519545-88519567 TTAAGCAATAAGAAGGGTACTGG + Intergenic
977312963 4:95410284-95410306 TCATGCATTTAGAGTGGTACAGG - Intronic
977691839 4:99920082-99920104 TTTTGAAATAAGAATGACACTGG + Intronic
977756864 4:100682341-100682363 TCATGCAATTATAGTGATACAGG + Intronic
977982321 4:103338750-103338772 TTCTGTATCTAGAATGATACAGG - Intergenic
978288521 4:107108843-107108865 TTATGGTATCAGAATGATGCTGG - Intronic
978586513 4:110280874-110280896 TGAAGCAGTTAAAATGATACAGG - Intergenic
979022979 4:115525738-115525760 TTAAGAAATTAACATGATACGGG - Intergenic
980236824 4:130118570-130118592 TTTTGCTATCAGAGTGATACTGG - Intergenic
980409985 4:132404154-132404176 GCATGCAATGGGAATGATACTGG - Intergenic
980583383 4:134783661-134783683 TTTTGGTATTAGAATGATGCTGG + Intergenic
981170083 4:141613233-141613255 TTCTGGATTTAGAATGATTCTGG - Intergenic
982332489 4:154196672-154196694 TTTTGGTATTAGGATGATACTGG + Intergenic
982400123 4:154957233-154957255 TAATACAAATAGAATCATACTGG + Intergenic
982830065 4:160048014-160048036 TTTTGGTATTAGGATGATACTGG - Intergenic
983036136 4:162868298-162868320 TTTTGCTATTAGGGTGATACTGG - Intergenic
983287146 4:165754164-165754186 TTATGGAATTACAATGAAAGGGG - Intergenic
983289613 4:165785484-165785506 TTGTGCAATTAGAATCATGCGGG + Intergenic
983438924 4:167755627-167755649 CCATGCAAAAAGAATGATACAGG + Intergenic
984724021 4:183002708-183002730 TGAAGCAGTTAAAATGATACAGG + Intergenic
984873867 4:184350288-184350310 TTAAGCAATTATAATGCTTCCGG - Intergenic
985395615 4:189540285-189540307 TTTTGCTATCAGAATGATGCTGG - Intergenic
985981377 5:3468862-3468884 TTATGAAACTAGCATGACACTGG + Intergenic
987176473 5:15315760-15315782 TTTTGGTATTAGGATGATACTGG - Intergenic
987436625 5:17902914-17902936 TTTTGGTATTAGCATGATACTGG + Intergenic
987546604 5:19318315-19318337 TTTGGCAAATAGAATTATACTGG + Intergenic
987553227 5:19410877-19410899 TTTTGCTATCAGAATGATGCTGG + Intergenic
987563819 5:19558803-19558825 TTTTAGTATTAGAATGATACTGG - Intronic
988134163 5:27147741-27147763 TGATGCTATTAGAATGATATAGG + Intergenic
988147839 5:27332814-27332836 TTATGGAATGAGAATATTACAGG - Intergenic
988177647 5:27747525-27747547 TTTTGAAATCAGGATGATACTGG - Intergenic
989029294 5:37101590-37101612 TTTTGGAATTAGGATGATGCTGG + Intergenic
990134287 5:52626647-52626669 TTATGGTATTAGAATGATGCTGG + Intergenic
990782220 5:59377952-59377974 TTATTCTATTATAATGACACAGG + Intronic
990892569 5:60664332-60664354 TAAAGCAGTTAAAATGATACAGG + Intronic
992017327 5:72589081-72589103 TTAATTAATTAAAATGATACTGG + Intergenic
992032530 5:72736760-72736782 TTTTGCTATCAGAATGATGCTGG + Intergenic
992985653 5:82226550-82226572 TTATGCAATTAGGATTATAATGG + Intronic
993607001 5:90003741-90003763 TTTTGGAATTAGGATAATACTGG - Intergenic
994284254 5:97945008-97945030 TTATACAATTTGAATGATGTTGG + Intergenic
994398825 5:99253298-99253320 TTTTTGAATTAGAGTGATACTGG + Intergenic
995876697 5:116797519-116797541 TTATATTATTAGAATCATACAGG + Intergenic
995979416 5:118083106-118083128 TTAAGCAATTAGAACAATCCAGG + Intergenic
996120872 5:119670813-119670835 TTTTGATATCAGAATGATACTGG - Intergenic
996323747 5:122249267-122249289 TTTTGGTATCAGAATGATACTGG + Intergenic
996619830 5:125486860-125486882 TTATGCATTGAGAATGATTCAGG - Intergenic
996850608 5:127947358-127947380 TAATGAAAATAGCATGATACTGG - Intergenic
997003804 5:129794722-129794744 TTTTGGTATTAGGATGATACTGG + Intergenic
997019835 5:129986511-129986533 TTTTGCTATCAGAATGATGCTGG + Intronic
997055059 5:130433483-130433505 TTTTGGAATTTGAATAATACTGG - Intergenic
999038116 5:148376210-148376232 TCATGCAATTAGGAGGATTCAGG + Intergenic
999677434 5:154018562-154018584 TTTTGGAATTAGGATGATACTGG - Intronic
999822754 5:155244611-155244633 TTTTGGAATTAGGGTGATACTGG + Intergenic
1000748919 5:165070813-165070835 TTATGGTATCAAAATGATACTGG + Intergenic
1001018980 5:168166732-168166754 CTATGCATCTAGAATGGTACTGG + Intronic
1002437922 5:179243960-179243982 TTATGCAATTTGAAGGACACAGG + Intronic
1002890938 6:1331261-1331283 TGAAGCAGTTAAAATGATACAGG - Intergenic
1004152079 6:13130812-13130834 TTTTGGAATTAGAGTGATACTGG - Intronic
1004687695 6:17963023-17963045 TTATGTAATTATAATCATATAGG - Intronic
1007837821 6:44688842-44688864 TTTTGGAATTAGAGTGATACTGG + Intergenic
1007869291 6:45014714-45014736 TTATGCAATTCCAATGTAACTGG - Intronic
1008185050 6:48378444-48378466 TCATGCAAATAGAATGATGCTGG - Intergenic
1008231793 6:48991789-48991811 TTTTGGTATTAGAGTGATACTGG - Intergenic
1009547915 6:65045983-65046005 TGATGCAATAATAATGAAACAGG - Intronic
1009830716 6:68928914-68928936 ATATGCAATTAGAATGTTTCTGG - Intronic
1010081376 6:71868144-71868166 TTATGAATTAAGTATGATACAGG + Intergenic
1010459058 6:76092856-76092878 TAATAAAATTGGAATGATACGGG + Intergenic
1010675672 6:78739969-78739991 TTATGCATTCAGTATGATATTGG + Intergenic
1010862779 6:80934265-80934287 TTTTGGTATTAGGATGATACTGG + Intergenic
1010934681 6:81847065-81847087 TTTTGCTATTAGGATGATGCTGG + Intergenic
1010989197 6:82460341-82460363 TTTTGGAAATATAATGATACTGG + Intergenic
1011084208 6:83521302-83521324 TTATTTAATTAGAATGAAAAAGG - Intronic
1011561241 6:88618689-88618711 GTATGCAATCAGATGGATACAGG - Intronic
1011589361 6:88956546-88956568 TTTTGGTATTAGAGTGATACTGG - Intronic
1012192011 6:96291608-96291630 TTTTGATATTAGGATGATACTGG - Intergenic
1012711064 6:102605698-102605720 TTTTGGAATTAGAATAATGCTGG - Intergenic
1013381581 6:109577469-109577491 TTTTGGTATTAGAGTGATACTGG + Intronic
1013788833 6:113812958-113812980 TTTTGCATTTAAAATAATACCGG - Intergenic
1013956797 6:115851640-115851662 TTATGAATTTAGAAAGAAACAGG - Intergenic
1014176697 6:118339031-118339053 TTTTGGTATCAGAATGATACTGG + Intergenic
1015348143 6:132183751-132183773 TTTTGATATTAGGATGATACTGG - Intergenic
1016289667 6:142515106-142515128 TTTTGGTATTAGGATGATACTGG + Intergenic
1016722294 6:147314696-147314718 TTATGCAATTATTATAAAACAGG - Intronic
1020374693 7:7471374-7471396 TTTTGGTATTAGGATGATACTGG - Intronic
1020957063 7:14753084-14753106 TTATAACATCAGAATGATACTGG - Intronic
1021204599 7:17765050-17765072 TTTTGGTATTAGAGTGATACTGG - Intergenic
1022738288 7:33096730-33096752 TTTTCCAATTAGAAAAATACAGG + Intronic
1023172468 7:37403205-37403227 TTATATAATTGGAATCATACAGG - Intronic
1024126239 7:46298826-46298848 TTTTACTATTAGAGTGATACTGG - Intergenic
1024848487 7:53679920-53679942 TTTTGGTATCAGAATGATACTGG + Intergenic
1028261955 7:88677430-88677452 TTTTGCTATTAGGGTGATACTGG - Intergenic
1028329233 7:89567980-89568002 TTTTGGAATCAGAATGATGCTGG - Intergenic
1028867207 7:95727178-95727200 TTATGGCACTTGAATGATACTGG + Intergenic
1029901252 7:104042301-104042323 TTTTGCTATTAGGATAATACTGG + Intergenic
1030092368 7:105868815-105868837 TTATTCTCATAGAATGATACAGG + Intronic
1030398199 7:109014703-109014725 TTTTGGTATCAGAATGATACTGG - Intergenic
1030446681 7:109654221-109654243 TTATGAAAATAGTCTGATACTGG - Intergenic
1030454573 7:109757295-109757317 TTATGAGATCAGAATGATGCTGG + Intergenic
1030783739 7:113634155-113634177 TTATGCAATCAAAATGACAATGG - Intergenic
1031720213 7:125165650-125165672 TGATGCATTTAGGATGATTCAGG + Intergenic
1031736285 7:125366234-125366256 TTTTGGTATCAGAATGATACTGG + Intergenic
1033623233 7:143081555-143081577 TTCTGGTATTAGGATGATACTGG - Intergenic
1033961264 7:146916304-146916326 TTTTGGTATTAGAGTGATACTGG + Intronic
1034370459 7:150591219-150591241 TTTTGGTATTAGGATGATACTGG + Intergenic
1037019811 8:13956431-13956453 TTTTGGAATTAGGATGATGCTGG - Intergenic
1037233018 8:16682586-16682608 TTATGAAATTATAAAAATACTGG + Intergenic
1038093911 8:24286193-24286215 TCATTCTATTATAATGATACAGG + Intergenic
1039323764 8:36462753-36462775 TTATGCAATTAGAAGAACAGAGG + Intergenic
1039808124 8:41020403-41020425 TTGTGCATTCAGTATGATACTGG + Intergenic
1040809613 8:51437342-51437364 TTTTGGTATTAGGATGATACTGG - Intronic
1041129646 8:54684297-54684319 TTTTGCTATCAGAATGATGCTGG + Intergenic
1041287802 8:56278605-56278627 TTTTGAAATCAGGATGATACTGG - Intergenic
1042053822 8:64740990-64741012 TTTTGCTATTAGAGTGATGCTGG - Intronic
1042419337 8:68567113-68567135 TTTTGGTATTAGAGTGATACTGG + Intronic
1043545392 8:81309798-81309820 TTTTGCTATTGGAGTGATACTGG - Intergenic
1043732697 8:83704168-83704190 TTGTGTTTTTAGAATGATACAGG + Intergenic
1043768985 8:84173476-84173498 TTATTCAATTAGAATAAGAAAGG - Intergenic
1046469880 8:114656788-114656810 TTATATAAATAGAATCATACAGG - Intergenic
1047647429 8:126883558-126883580 CTATGCATCTAGAATGGTACTGG + Intergenic
1047671718 8:127155307-127155329 TTTTGGTATTAGGATGATACTGG - Intergenic
1047863463 8:128994799-128994821 TTACGCATTCAGTATGATACTGG - Intergenic
1051601076 9:18874752-18874774 TTTTGGTATTAGGATGATACTGG + Intronic
1051741517 9:20256977-20256999 TTGTGCAAAGAGAATAATACTGG - Intergenic
1052253847 9:26430354-26430376 TTTTGCTATTAGGGTGATACTGG - Intergenic
1054854125 9:69879728-69879750 TTATCCAATTAGAGTCATAGTGG + Intronic
1054918793 9:70521486-70521508 TTATACATTGAGAATGATAGGGG + Intergenic
1055125366 9:72713260-72713282 TTTTGCTATTAGGATGATGCTGG + Intronic
1055954977 9:81765056-81765078 TTATGCAAATAGAAAGAAACAGG - Intergenic
1056026950 9:82508264-82508286 TTTTGGAATTAGGGTGATACTGG - Intergenic
1057319911 9:94003026-94003048 TCATGTAAATAGAATGACACAGG - Intergenic
1058228127 9:102392209-102392231 TTTTGGTATTAGGATGATACTGG + Intergenic
1058241473 9:102567302-102567324 TTATGGAAGTAGAATGAAATGGG - Intergenic
1058616358 9:106832654-106832676 TTTTGGTATCAGAATGATACTGG + Intergenic
1058784291 9:108371238-108371260 TTTTGGTATTAGGATGATACTGG + Intergenic
1059674057 9:116520155-116520177 TTTTGGTATTAGGATGATACTGG - Intronic
1061336931 9:129944598-129944620 TAATGCAAGGAGAAGGATACAGG + Intronic
1061599849 9:131660858-131660880 TTATGCAAGTAAAATGAAAAGGG - Intronic
1188837962 X:34981798-34981820 TTTTGGTATTAGGATGATACTGG - Intergenic
1189639034 X:43047523-43047545 TTTTGGAATTAGGGTGATACAGG + Intergenic
1189880294 X:45484343-45484365 TTTTGCTATTAGATTAATACTGG + Intergenic
1190292807 X:49003922-49003944 TCATGCAAATAGAATGAGACAGG + Intergenic
1190631894 X:52395687-52395709 TTTTGGTATTAGGATGATACTGG + Intergenic
1191077020 X:56465561-56465583 TTTTAGTATTAGAATGATACTGG + Intergenic
1191139207 X:57097917-57097939 AGATGCAATAAAAATGATACAGG + Intergenic
1191209887 X:57873430-57873452 TTTTGCCATCAGAATGATGCTGG - Intergenic
1191624185 X:63251083-63251105 TTCTGGTATTAGAATAATACTGG - Intergenic
1192064725 X:67870487-67870509 TTATGCAAGTAGAATCACGCAGG + Intergenic
1192912040 X:75615295-75615317 TTTTGCTATCAGAATGATCCTGG - Intergenic
1193090512 X:77489020-77489042 TTGTTCTATCAGAATGATACAGG + Intergenic
1193188569 X:78542096-78542118 TTTTGGAATCAGAATAATACTGG + Intergenic
1193283051 X:79678328-79678350 TTTTGGAATCAGGATGATACTGG - Intergenic
1193397995 X:81008591-81008613 TTTTGGAATTAGGGTGATACTGG + Intergenic
1193529393 X:82638112-82638134 TTTTGGTATTAGAATAATACTGG + Intergenic
1193551759 X:82902162-82902184 TTTTGGTATTAGAATGATGCTGG - Intergenic
1193637626 X:83971844-83971866 TTGCCCATTTAGAATGATACTGG - Intergenic
1193775695 X:85638719-85638741 TTTTGCTATTAGGGTGATACTGG + Intergenic
1193924741 X:87470248-87470270 TTTTGATATTAGGATGATACTGG - Intergenic
1194012272 X:88577023-88577045 TTTTGGTATTAGGATGATACTGG + Intergenic
1194126496 X:90024414-90024436 TTATGATATCAAAATGATACTGG - Intergenic
1194545460 X:95228350-95228372 TTTTGGAATCAGAATGATGCTGG - Intergenic
1195076505 X:101332066-101332088 TTTTGGTATTAGAATGATAGTGG - Intergenic
1195203508 X:102572319-102572341 TTTTGAAATTAGAATAATAGTGG + Intergenic
1196209044 X:112973840-112973862 TTATGAAATGAGAATGAAAGAGG + Intergenic
1196531035 X:116786525-116786547 TTTTGGTATTAGAGTGATACTGG - Intergenic
1197090508 X:122530674-122530696 TTATGTTATCAGAGTGATACTGG - Intergenic
1197575968 X:128211886-128211908 TTATGATATTAGGGTGATACTGG - Intergenic
1197741522 X:129898366-129898388 TTATATAAATAGAATCATACAGG - Intergenic
1197954520 X:131931701-131931723 TGAAGCAGTTAAAATGATACAGG - Intergenic
1198169033 X:134087087-134087109 TTTTGGCATTAGGATGATACTGG - Intergenic
1198627576 X:138595193-138595215 TTTTGCATTGAGTATGATACTGG + Intergenic
1198784133 X:140269364-140269386 TTTTGCAATCAGGATGATACTGG + Intergenic
1198929612 X:141839387-141839409 TTATGTAATTATAATGATTATGG + Intronic
1198950298 X:142062182-142062204 TTTTGGTATTAGAGTGATACTGG + Intergenic
1198979254 X:142376260-142376282 ATATGCAAATAGAATAATAATGG - Intergenic
1199098678 X:143771676-143771698 TTATGGTATTAGGATGATGCTGG - Intergenic
1199356860 X:146872664-146872686 TTAAGCAATTAGGATGATTTTGG - Intergenic
1199913278 X:152311213-152311235 TTTTGGTATCAGAATGATACTGG - Intronic
1199953730 X:152725859-152725881 ATGTGCAATGAGAATGATCCAGG + Intergenic
1200340184 X:155388518-155388540 TTTTGGTATTAGAATGATACTGG + Intergenic
1201483059 Y:14461408-14461430 TTACCCATTTAGTATGATACTGG - Intergenic