ID: 951517226

View in Genome Browser
Species Human (GRCh38)
Location 3:23573727-23573749
Sequence TTTAGGTATTGCAAGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951517226_951517229 10 Left 951517226 3:23573727-23573749 CCTCCACACTTGCAATACCTAAA 0: 1
1: 0
2: 0
3: 2
4: 126
Right 951517229 3:23573760-23573782 TTGTCAGCTGATTAAAAGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 97
951517226_951517231 20 Left 951517226 3:23573727-23573749 CCTCCACACTTGCAATACCTAAA 0: 1
1: 0
2: 0
3: 2
4: 126
Right 951517231 3:23573770-23573792 ATTAAAAGCGTGGATTTTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 179
951517226_951517230 19 Left 951517226 3:23573727-23573749 CCTCCACACTTGCAATACCTAAA 0: 1
1: 0
2: 0
3: 2
4: 126
Right 951517230 3:23573769-23573791 GATTAAAAGCGTGGATTTTGTGG 0: 1
1: 0
2: 1
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951517226 Original CRISPR TTTAGGTATTGCAAGTGTGG AGG (reversed) Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905627889 1:39500358-39500380 TTTAGTTGTTGCAAATGGGGAGG + Intronic
905781740 1:40716946-40716968 TTTAGGAAGAGCAAGTTTGGGGG + Intronic
907094656 1:51766781-51766803 TTTAGGGAGGCCAAGTGTGGTGG + Intronic
910845019 1:91596333-91596355 TTTAGGTATTCTGTGTGTGGTGG - Intergenic
913231384 1:116743212-116743234 ATTAGGTGATGAAAGTGTGGAGG + Intergenic
917512835 1:175682433-175682455 TTTAGATATGGAAAGAGTGGAGG - Intronic
921150729 1:212400558-212400580 GTTACTTATAGCAAGTGTGGAGG - Intronic
921340953 1:214133788-214133810 TTTAGGTATGGCAGGGATGGTGG - Intergenic
1064090406 10:12378396-12378418 TTTAAGTTTGCCAAGTGTGGTGG - Intronic
1064406245 10:15066395-15066417 GTTACTTATTGTAAGTGTGGAGG + Intronic
1064828425 10:19432837-19432859 TTTGGATATTGCAAGTTTGGGGG - Intronic
1064886251 10:20115676-20115698 TTTAGATATGGGAAGTATGGGGG - Intronic
1066456576 10:35577432-35577454 TTTAGGAATTGCACCTGTGTCGG - Intergenic
1066586956 10:36946016-36946038 TTTTGGTATGGCAGCTGTGGAGG - Intergenic
1068056891 10:52022548-52022570 TTTAAGTATTTCAAGTGTTCTGG + Intronic
1068156361 10:53204939-53204961 TGTAGGCTATGCAAGTGTGGTGG + Intergenic
1068960558 10:62862817-62862839 TTTAGGAACTGCTAGGGTGGAGG - Intronic
1069409479 10:68138436-68138458 TTTTTTAATTGCAAGTGTGGTGG + Intronic
1072177397 10:92941833-92941855 TTTTAGTAATTCAAGTGTGGGGG - Intronic
1073575803 10:104622281-104622303 TGTAGCCATTGCAAGTATGGGGG - Intergenic
1085092331 11:73728184-73728206 TTTTGGTATTGAAACTGTGTAGG + Intronic
1087761258 11:102106403-102106425 TTTAAGTAGGCCAAGTGTGGTGG - Intergenic
1090602117 11:128383746-128383768 CTCAGGTGTTGGAAGTGTGGTGG - Intergenic
1092392234 12:8090958-8090980 TTTAGGTTTTGCAGGTCAGGTGG + Intronic
1093136267 12:15455312-15455334 TTCAGGTATTGTGTGTGTGGGGG - Intronic
1094291191 12:28851966-28851988 TTTAGGTCTGGCAAGTGGGATGG - Intergenic
1096371742 12:51074597-51074619 TTTAGGTATAGTCAGTCTGGAGG - Intronic
1097424584 12:59427671-59427693 TTCAGGTGTTGCCAGTGTGTTGG - Intergenic
1097769054 12:63559308-63559330 TTTTGTTATTTCAAGTGTAGAGG + Exonic
1098083891 12:66820335-66820357 ATTTGGTATTGCCAGTGTTGTGG - Intergenic
1098157214 12:67612201-67612223 TTTAGAGAATGCAAATGTGGAGG + Intergenic
1107343465 13:39434709-39434731 TTTTTTTATTGCAAGCGTGGAGG - Intronic
1107466571 13:40655943-40655965 TTTAGAAATGGCAAGTGTTGAGG - Intronic
1107810605 13:44196464-44196486 TTTAGGTGTTGTATGTGTTGTGG - Intergenic
1114195261 14:20470987-20471009 TTTAGGAATTGCTGGTCTGGAGG - Intronic
1120080298 14:80208787-80208809 TTCAAGTATGGCAAGGGTGGTGG - Intronic
1121801266 14:96776077-96776099 TTTTGGTATTGGAAGTGCAGGGG - Intergenic
1128077627 15:64837842-64837864 TTTAGATATGGTATGTGTGGTGG - Intergenic
1129921899 15:79326512-79326534 TTTAGCTATTGCTAGTCTTGGGG + Intronic
1146432058 17:32806680-32806702 TTTAGATATTCAAAATGTGGAGG - Intronic
1153213491 18:2794086-2794108 TTTAGGTTTTGCAAGTCAAGTGG + Intronic
1154113930 18:11594316-11594338 TTTAGGCATAGCAAGTTTGGGGG - Intergenic
1157258700 18:46160475-46160497 TTTGGTTATTGGAAGTGAGGAGG + Intergenic
1157542614 18:48522448-48522470 TTGAGGACTTGCCAGTGTGGCGG - Intergenic
1157627114 18:49060354-49060376 TGTAGGAAATGGAAGTGTGGTGG - Intronic
1157791781 18:50538614-50538636 TTTAGTTTTTGCAATTCTGGTGG + Intergenic
1158403439 18:57140983-57141005 TTTGGGAATTGCAAGTCTGTGGG + Intergenic
1159810500 18:73013100-73013122 TTTAGCTATGGCAGTTGTGGTGG - Intergenic
1163878158 19:19893406-19893428 TTTATGTATAGGAAATGTGGAGG - Exonic
1164785432 19:30926711-30926733 TTTAGATATGGGAAGCGTGGTGG - Intergenic
1168568009 19:57440643-57440665 TGTTAGTATTGCAAGAGTGGAGG + Intronic
930572252 2:53101973-53101995 TTCAGGTGTTGCCAGTGTGATGG - Intergenic
932081287 2:68717769-68717791 TTAAGGTGTTCCAAGTGTAGGGG + Intronic
933522501 2:83391169-83391191 TTTGGCTCTTGCAATTGTGGAGG - Intergenic
940544802 2:155070209-155070231 TTGAGGTATTGCATCTATGGTGG - Intergenic
942220732 2:173766722-173766744 ATTAGGTATTTCAAGGCTGGTGG - Intergenic
944425157 2:199573750-199573772 TTTAGGTATTGCATGAGTAAGGG - Intergenic
945154860 2:206827915-206827937 TTTAGGACATGCAGGTGTGGAGG - Intergenic
946368676 2:219266842-219266864 TTTAGGTGTGGGGAGTGTGGGGG + Intronic
948399911 2:237676446-237676468 TTCATGAATTGCAAATGTGGAGG + Intronic
1169502356 20:6173159-6173181 TTTAGCTACTTCAAGTTTGGGGG - Intergenic
1170925682 20:20721317-20721339 TTTAAGGATAGCAACTGTGGTGG + Intergenic
1172081599 20:32345527-32345549 TTGAGCTATTGCACGTCTGGGGG + Intergenic
1176123152 20:63463252-63463274 TTTATTTATTTTAAGTGTGGGGG - Intronic
1177397604 21:20557644-20557666 TTTAGATTTTGCAAGTTAGGGGG + Intergenic
1178294596 21:31398508-31398530 TTTAGATATTTGAAGTGTGATGG - Intronic
951517226 3:23573727-23573749 TTTAGGTATTGCAAGTGTGGAGG - Intronic
952500618 3:33958373-33958395 ATTAGGTATTATAAGTGTGTAGG + Intergenic
954955396 3:54514255-54514277 TTTTGGTATGGCAAGTTTGCAGG - Intronic
955025630 3:55164678-55164700 TTTGGGTGTTCAAAGTGTGGAGG + Intergenic
956149025 3:66221934-66221956 TTTTGGTGTTGCAGGTGTTGAGG + Intronic
959580228 3:107976005-107976027 TTTAAATTTTGAAAGTGTGGGGG - Intergenic
960255147 3:115503853-115503875 CTAAGGTATTGAAAGTGGGGAGG - Intergenic
960825434 3:121778473-121778495 TTTTGGTAGTGCAAGTGTACTGG + Intronic
961223890 3:125221521-125221543 TGAAGGTATTAGAAGTGTGGTGG - Intergenic
964081307 3:152761524-152761546 TTTGGGTAATGCAAACGTGGGGG - Intergenic
970670514 4:18391608-18391630 TTGAGGTATTAGATGTGTGGGGG - Intergenic
971515993 4:27486838-27486860 TTTCTGTATTCCAATTGTGGTGG - Intergenic
975828353 4:78342859-78342881 TTTGGGTAGTGAAAGTCTGGGGG + Intronic
977036764 4:91963198-91963220 TTTAGATTTTGCAAGCGTGAAGG - Intergenic
978316280 4:107440976-107440998 TTTTGGTATGGCATGGGTGGAGG - Intergenic
981426710 4:144611796-144611818 TCTAGTTATTGAAACTGTGGAGG + Intergenic
981624628 4:146741708-146741730 TTTAGGTATTGCAGTTGTACAGG - Intronic
982157868 4:152539322-152539344 TTTTGGTTTTGCCAGTCTGGTGG + Intergenic
982876027 4:160650990-160651012 TTTTACTATTGCAATTGTGGGGG + Intergenic
987280022 5:16403625-16403647 TCTAGTTTTTGCAAGTTTGGTGG + Intergenic
987779038 5:22408768-22408790 TTTAGGTCTTTAAAATGTGGTGG - Intronic
992558864 5:77930352-77930374 AATAGGTATTGGAAGGGTGGAGG - Intergenic
992630827 5:78678620-78678642 GCTATGGATTGCAAGTGTGGTGG - Intronic
995581062 5:113603169-113603191 TTGAAGTTTTGCAAGTCTGGTGG - Intergenic
998615705 5:143737814-143737836 TCAAGGAATTGCATGTGTGGTGG + Intergenic
999208511 5:149867864-149867886 ATTTGGAATTGCAAGTGGGGTGG - Intronic
999799882 5:155023530-155023552 TTTAGCTATGGCCAGGGTGGAGG + Intergenic
999888523 5:155950935-155950957 TTTAGGAATTGCATGTGAGCTGG + Intronic
1000823101 5:166009865-166009887 TTTAGGTGTTGCTAATGTGATGG + Intergenic
1004188763 6:13446276-13446298 TTTGGGAATTGCAAGTGTACAGG - Intronic
1004413997 6:15407704-15407726 TTTTGGTATTGCAAGCTTGCCGG + Intronic
1010622601 6:78094541-78094563 TTTAGGTATTGCCATATTGGTGG + Intergenic
1011553152 6:88548224-88548246 TCTAGGTATTGCTAGTCTGTGGG - Intergenic
1018657098 6:166047712-166047734 TTTAGGTTTTGCAATTCTAGAGG - Intergenic
1019372083 7:667584-667606 TTTAGGCATTGCCAGTGAGCGGG - Intronic
1021126107 7:16852501-16852523 TTTACCTAGAGCAAGTGTGGAGG + Intergenic
1021337793 7:19425139-19425161 CTTATGTATGGCAAGTGGGGTGG + Intergenic
1022928332 7:35080379-35080401 TTTTGTTATTTCAAGTGTAGAGG + Intergenic
1025887671 7:65613745-65613767 GTTAGGTATTTGAAGTGTTGTGG - Intergenic
1028373948 7:90125185-90125207 TTTTGTTATTTCAAGTGTAGAGG - Intergenic
1030070263 7:105692249-105692271 CTTAGATTTTGCAAATGTGGAGG + Intronic
1030587458 7:111438003-111438025 TTTAGGAATTGAAAATGTTGAGG - Intronic
1030624321 7:111827613-111827635 ATTAGGTAATGGAAGTGAGGTGG + Intronic
1030695626 7:112581895-112581917 TTGAGGCATTGAAAGGGTGGAGG + Intergenic
1031854738 7:126908173-126908195 GTTAGGTATTTGAAGTGTTGTGG + Intronic
1032646676 7:133832812-133832834 TTTATGTATTGAAATTGTAGGGG + Intronic
1038375477 8:27036158-27036180 TTTAGGTATTCCAGGAGTCGGGG - Intergenic
1043508320 8:80924623-80924645 TTTCTGTCTTGCAGGTGTGGTGG + Intergenic
1044806463 8:96013183-96013205 TTTTGGTACTGGAAGTGGGGTGG + Intergenic
1047155580 8:122313988-122314010 GTTAGGTTTTGCAAATGTCGTGG - Intergenic
1047180302 8:122581395-122581417 TTTATGGATTGCAGGTGTAGTGG - Intergenic
1050635370 9:7606688-7606710 TTTCTGTATTGCAAGTGGGCTGG + Intergenic
1054965044 9:71015352-71015374 TGTAGGTAATGCCAATGTGGAGG + Intronic
1055142460 9:72891366-72891388 TTTAGGCATTTCAAGTCTTGAGG - Intergenic
1058607153 9:106735149-106735171 TTCAAGTAATGAAAGTGTGGTGG - Intergenic
1060035469 9:120251858-120251880 TTTAGGCAAGGCATGTGTGGAGG + Intergenic
1190369833 X:49730048-49730070 TTTATGTCTTGCAATTCTGGTGG - Intergenic
1192304982 X:69949736-69949758 TGTAGGTGTTGCCAATGTGGTGG + Intronic
1194728538 X:97427448-97427470 TATATGTATTTCAACTGTGGTGG - Intronic
1198669300 X:139061582-139061604 TTTATTTATTGCAATTCTGGAGG - Intronic
1198920237 X:141717281-141717303 TTTTGGTGTTGCCAGTGTGATGG - Intergenic
1200932783 Y:8712188-8712210 TATAAGAATAGCAAGTGTGGAGG + Intergenic