ID: 951517864

View in Genome Browser
Species Human (GRCh38)
Location 3:23581617-23581639
Sequence CTTAGTTCCACCACGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951517864_951517866 -2 Left 951517864 3:23581617-23581639 CCTGACTCCGTGGTGGAACTAAG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 951517866 3:23581638-23581660 AGTTAAAAACCCAGACATTCTGG 0: 1
1: 0
2: 2
3: 27
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951517864 Original CRISPR CTTAGTTCCACCACGGAGTC AGG (reversed) Intronic
901245028 1:7723504-7723526 CTAAGTTCCACCTCGCAGACGGG - Intronic
902778664 1:18690699-18690721 CTAATTTCCACCATGGAGACTGG - Intronic
905166169 1:36084449-36084471 CTTAGATCCCCCACGGGGACTGG + Intronic
906100471 1:43257198-43257220 TTCAGTTTCCCCACGGAGTCTGG - Intronic
912445768 1:109735076-109735098 TTAACTTCCACCATGGAGTCTGG + Exonic
924101711 1:240610435-240610457 CTTAGCTCTACCATAGAGTCAGG - Intronic
1074748770 10:116562766-116562788 CTTGTTTCCACCAAGCAGTCTGG + Intronic
1075188525 10:120284940-120284962 CTTACTTCCACCACGCAGGAAGG + Intergenic
1078850506 11:15158793-15158815 TTGAGTTCCAGCAAGGAGTCAGG - Intronic
1078935056 11:15942532-15942554 CTTAGTTCCAGCACTGACTATGG + Intergenic
1086374488 11:86186418-86186440 CTCAGTCCCACCACGGAGTCAGG - Intergenic
1094818650 12:34208743-34208765 CCCAGCTCCACCACGGACTCGGG + Intergenic
1097287442 12:57888945-57888967 CTCAGTTCCTCCATGGAGGCTGG - Intergenic
1113743144 13:112724856-112724878 CCTCATTCCACCACGGAGCCAGG + Intronic
1120171868 14:81254396-81254418 CTTTGTTCCACCATTCAGTCTGG + Intergenic
1127228297 15:56959139-56959161 CTTAGGTCCAACACAGTGTCTGG + Intronic
1127827442 15:62717492-62717514 GTCACTTCCACCACAGAGTCAGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1150864369 17:68834063-68834085 CTTTGTTCCACCATTGAGCCAGG + Intergenic
1151078875 17:71305142-71305164 CCCAGTACCAGCACGGAGTCTGG + Intergenic
1154183299 18:12156473-12156495 ATTAGATCCACTACTGAGTCAGG + Intergenic
1158858732 18:61570966-61570988 CTTAGATCCATGTCGGAGTCTGG - Intergenic
1160423479 18:78765224-78765246 CTTCGTTCCACCATGGAGCAGGG - Intergenic
928815670 2:35292198-35292220 CTGAGTTTCACCACCGAGTGGGG + Intergenic
935447718 2:103174443-103174465 TTAAGTTCTACCACGGAGCCTGG - Intergenic
942654135 2:178196646-178196668 CTTAGTACCACCACAGATACCGG + Intronic
944204047 2:197138516-197138538 ATTAGTTCCAACACAGTGTCAGG + Intronic
1172882012 20:38208243-38208265 CAGAGTTCCCCCACGCAGTCAGG + Intergenic
1173835697 20:46123844-46123866 CTTAGTTCCAACAGAGAGACAGG - Intronic
1173938701 20:46891676-46891698 CACAGTTCCACCCCAGAGTCTGG + Intergenic
1180410307 22:12601322-12601344 CCTGGTAGCACCACGGAGTCAGG - Intergenic
1181529761 22:23510740-23510762 CTGAGCTCCACCCGGGAGTCAGG + Intergenic
951517864 3:23581617-23581639 CTTAGTTCCACCACGGAGTCAGG - Intronic
955911801 3:63864643-63864665 CCCAATTCCACCACAGAGTCGGG + Intronic
956398962 3:68856104-68856126 TTTCCTTACACCACGGAGTCTGG - Intronic
956889410 3:73597216-73597238 CTTTGTTCCACCAAGTAGCCTGG + Intronic
963563244 3:146894259-146894281 TTTAGTTTCACCATGGAATCAGG - Intergenic
967084948 3:186086049-186086071 CTTACTACCACCACTGAGGCAGG + Intronic
969738803 4:9009430-9009452 CTTAGCTTCTCCAGGGAGTCTGG + Intergenic
970784942 4:19784162-19784184 CTCATTTCTACCACGTAGTCAGG + Intergenic
976176280 4:82356037-82356059 CTTAGTTGCACAATGAAGTCAGG + Intronic
996494049 5:124132796-124132818 CTTTGTTCCACCACTGACACAGG + Intergenic
998911305 5:146963351-146963373 CTTAGCACCACCACGGAGTAGGG + Intronic
1002324774 5:178397158-178397180 CTCAGTACCACCTTGGAGTCAGG + Intronic
1009561383 6:65248943-65248965 CTGAGCTCCACAAAGGAGTCTGG - Intronic
1020704279 7:11524176-11524198 CTGAGTACCACCACAGAGCCAGG - Intronic
1024604309 7:51011977-51011999 GTTATTTCCACCACTGAGACAGG - Intergenic
1033035494 7:137872489-137872511 CTTAGTTCCATCACTGATACAGG + Intergenic
1036182724 8:6598739-6598761 CTTAGTCCCACCACGCAGGGGGG - Intronic
1045259891 8:100563261-100563283 CTTAGCACCACCACGGTGACTGG + Intergenic
1048387937 8:133930645-133930667 ATAAATTCCACCACGGAATCTGG + Intergenic
1056785501 9:89589969-89589991 CTTTGTTCCAGAACGGATTCAGG + Intergenic
1060196776 9:121629100-121629122 CTTGGGTCCATCACTGAGTCTGG - Intronic
1190410839 X:50135815-50135837 ATCAGTTCCACCCAGGAGTCAGG + Intergenic
1191819837 X:65293192-65293214 CTCAGTACCACCCTGGAGTCTGG + Intergenic